ID: 1130938885

View in Genome Browser
Species Human (GRCh38)
Location 15:88491476-88491498
Sequence CACGCCCCAGCCTCCTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130938885_1130938893 10 Left 1130938885 15:88491476-88491498 CCTGCAGAGGAGGCTGGGGCGTG No data
Right 1130938893 15:88491509-88491531 CCGAGCAGGGCTGTGATCAGAGG No data
1130938885_1130938889 -3 Left 1130938885 15:88491476-88491498 CCTGCAGAGGAGGCTGGGGCGTG No data
Right 1130938889 15:88491496-88491518 GTGCCTAAGGGTCCCGAGCAGGG No data
1130938885_1130938894 15 Left 1130938885 15:88491476-88491498 CCTGCAGAGGAGGCTGGGGCGTG No data
Right 1130938894 15:88491514-88491536 CAGGGCTGTGATCAGAGGCATGG No data
1130938885_1130938895 25 Left 1130938885 15:88491476-88491498 CCTGCAGAGGAGGCTGGGGCGTG No data
Right 1130938895 15:88491524-88491546 ATCAGAGGCATGGCAACACTTGG No data
1130938885_1130938888 -4 Left 1130938885 15:88491476-88491498 CCTGCAGAGGAGGCTGGGGCGTG No data
Right 1130938888 15:88491495-88491517 CGTGCCTAAGGGTCCCGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130938885 Original CRISPR CACGCCCCAGCCTCCTCTGC AGG (reversed) Intergenic