ID: 1130938888

View in Genome Browser
Species Human (GRCh38)
Location 15:88491495-88491517
Sequence CGTGCCTAAGGGTCCCGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130938885_1130938888 -4 Left 1130938885 15:88491476-88491498 CCTGCAGAGGAGGCTGGGGCGTG No data
Right 1130938888 15:88491495-88491517 CGTGCCTAAGGGTCCCGAGCAGG No data
1130938879_1130938888 11 Left 1130938879 15:88491461-88491483 CCAGGCAGTGAAGGGCCTGCAGA No data
Right 1130938888 15:88491495-88491517 CGTGCCTAAGGGTCCCGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130938888 Original CRISPR CGTGCCTAAGGGTCCCGAGC AGG Intergenic