ID: 1130940955

View in Genome Browser
Species Human (GRCh38)
Location 15:88508640-88508662
Sequence ATTTCATGTTGCCAATACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130940955_1130940959 10 Left 1130940955 15:88508640-88508662 CCACTGTATTGGCAACATGAAAT No data
Right 1130940959 15:88508673-88508695 CTGGACAACTGCAGTTTCAGAGG No data
1130940955_1130940960 13 Left 1130940955 15:88508640-88508662 CCACTGTATTGGCAACATGAAAT No data
Right 1130940960 15:88508676-88508698 GACAACTGCAGTTTCAGAGGAGG No data
1130940955_1130940962 15 Left 1130940955 15:88508640-88508662 CCACTGTATTGGCAACATGAAAT No data
Right 1130940962 15:88508678-88508700 CAACTGCAGTTTCAGAGGAGGGG No data
1130940955_1130940957 -9 Left 1130940955 15:88508640-88508662 CCACTGTATTGGCAACATGAAAT No data
Right 1130940957 15:88508654-88508676 ACATGAAATCACTGGTGACCTGG No data
1130940955_1130940961 14 Left 1130940955 15:88508640-88508662 CCACTGTATTGGCAACATGAAAT No data
Right 1130940961 15:88508677-88508699 ACAACTGCAGTTTCAGAGGAGGG No data
1130940955_1130940963 18 Left 1130940955 15:88508640-88508662 CCACTGTATTGGCAACATGAAAT No data
Right 1130940963 15:88508681-88508703 CTGCAGTTTCAGAGGAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130940955 Original CRISPR ATTTCATGTTGCCAATACAG TGG (reversed) Intergenic
No off target data available for this crispr