ID: 1130940963

View in Genome Browser
Species Human (GRCh38)
Location 15:88508681-88508703
Sequence CTGCAGTTTCAGAGGAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130940955_1130940963 18 Left 1130940955 15:88508640-88508662 CCACTGTATTGGCAACATGAAAT No data
Right 1130940963 15:88508681-88508703 CTGCAGTTTCAGAGGAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130940963 Original CRISPR CTGCAGTTTCAGAGGAGGGG TGG Intergenic
No off target data available for this crispr