ID: 1130942067

View in Genome Browser
Species Human (GRCh38)
Location 15:88519099-88519121
Sequence AAAGGTAAAATGATGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 449}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130942058_1130942067 3 Left 1130942058 15:88519073-88519095 CCTGACTCACCGACTCCCTGGCT 0: 1
1: 0
2: 0
3: 21
4: 232
Right 1130942067 15:88519099-88519121 AAAGGTAAAATGATGGGGGCTGG 0: 1
1: 0
2: 3
3: 43
4: 449
1130942055_1130942067 8 Left 1130942055 15:88519068-88519090 CCCTGCCTGACTCACCGACTCCC 0: 1
1: 0
2: 6
3: 38
4: 341
Right 1130942067 15:88519099-88519121 AAAGGTAAAATGATGGGGGCTGG 0: 1
1: 0
2: 3
3: 43
4: 449
1130942056_1130942067 7 Left 1130942056 15:88519069-88519091 CCTGCCTGACTCACCGACTCCCT 0: 1
1: 0
2: 0
3: 18
4: 252
Right 1130942067 15:88519099-88519121 AAAGGTAAAATGATGGGGGCTGG 0: 1
1: 0
2: 3
3: 43
4: 449
1130942053_1130942067 28 Left 1130942053 15:88519048-88519070 CCATCTCATCTACACCTTAGCCC 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1130942067 15:88519099-88519121 AAAGGTAAAATGATGGGGGCTGG 0: 1
1: 0
2: 3
3: 43
4: 449
1130942060_1130942067 -6 Left 1130942060 15:88519082-88519104 CCGACTCCCTGGCTTTCAAAGGT 0: 1
1: 0
2: 2
3: 17
4: 226
Right 1130942067 15:88519099-88519121 AAAGGTAAAATGATGGGGGCTGG 0: 1
1: 0
2: 3
3: 43
4: 449
1130942054_1130942067 14 Left 1130942054 15:88519062-88519084 CCTTAGCCCTGCCTGACTCACCG 0: 1
1: 0
2: 2
3: 15
4: 229
Right 1130942067 15:88519099-88519121 AAAGGTAAAATGATGGGGGCTGG 0: 1
1: 0
2: 3
3: 43
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130942067 Original CRISPR AAAGGTAAAATGATGGGGGC TGG Intronic
901360863 1:8698811-8698833 AAAAGTAAAGTGTTGGGGCCAGG - Intronic
901697194 1:11017179-11017201 AAAGGTAACAAGATTGTGGCTGG - Intronic
901971620 1:12913201-12913223 AAAGGGAAAATCATGGAGGATGG - Intronic
902013547 1:13288539-13288561 AAAGGGAAAATCATGGAGGATGG + Intergenic
902068235 1:13707690-13707712 AAATGTAAAAATCTGGGGGCAGG - Intronic
902564616 1:17303119-17303141 AAAGGAGAGATGCTGGGGGCAGG + Intergenic
902655661 1:17866239-17866261 AAGGGGAAAATGATGGGGGAGGG - Intergenic
902873120 1:19326035-19326057 AAAGGTGAAACGCTGAGGGCAGG - Intronic
903031623 1:20467795-20467817 ATGGGTCAAATGATGGGGGTGGG - Intergenic
903176597 1:21585238-21585260 GAAGGGAACATGGTGGGGGCGGG + Intergenic
905891595 1:41521697-41521719 AGAGGTAAAGTGATGGGTGTCGG + Intronic
905900877 1:41581362-41581384 AAAGGGAGACTGGTGGGGGCAGG + Exonic
907790588 1:57659677-57659699 AATGAAAAAAAGATGGGGGCTGG + Intronic
908883022 1:68754653-68754675 AAAGATTAAAAGATGGGGCCGGG + Intergenic
909762257 1:79305102-79305124 AAAGGTAAAATGATTGGCCTGGG - Intergenic
910119447 1:83769405-83769427 AAAGGTAAAATTATGAAGGAAGG - Intergenic
910212419 1:84807024-84807046 AAAAATAAAATGCTGGGGCCGGG - Intergenic
912773044 1:112482489-112482511 AAAGATAAAATTAGTGGGGCTGG - Intronic
912912650 1:113778144-113778166 AAAAGTAAAATCATCAGGGCAGG + Intronic
913360792 1:117978015-117978037 AATGGTAAAATGATCGGGGTTGG - Intronic
913437216 1:118859594-118859616 AAAGGGACAATTTTGGGGGCAGG - Intergenic
915396121 1:155585800-155585822 GAAAGGAAAAAGATGGGGGCAGG - Intergenic
915411918 1:155707666-155707688 AAAGGGAAGAAGATTGGGGCAGG - Intronic
915550387 1:156629464-156629486 ATAGATAAAATGAAGGGGGCAGG - Intergenic
917299082 1:173554317-173554339 AAAGGGGAAATGGTGGGGGAGGG - Intronic
918167511 1:181964650-181964672 AAAGGTAGAATGATGTGGTTTGG - Intergenic
918685540 1:187410151-187410173 AAAGGGAAAATGCTGGTAGCCGG + Intergenic
919417525 1:197330069-197330091 AAAAGTAAAATGATGCTGGAGGG - Intronic
919462926 1:197900458-197900480 AAATGAAAATTGAAGGGGGCAGG + Intergenic
919927184 1:202198193-202198215 ACAGCCAAAATGATGGAGGCAGG + Intronic
920444004 1:206002023-206002045 AAAGATAGTATGATGGGGGCGGG - Intronic
920666452 1:207966085-207966107 AAGTCTAAAAAGATGGGGGCAGG + Intergenic
920833698 1:209488214-209488236 GAAGGGAATATGATGTGGGCAGG + Intergenic
921992002 1:221376947-221376969 ATAGATAAAATGAGGGGGGATGG + Intergenic
922213301 1:223501437-223501459 AATAGTAAAATGGTGAGGGCAGG + Intergenic
922248604 1:223825612-223825634 AGAGGTAGAATGATGGTAGCAGG - Intronic
922791400 1:228313171-228313193 AAAGGGCAAAGGATGGGGGTGGG + Intronic
924495702 1:244586461-244586483 AAAGATTTAATGATGGTGGCTGG + Intronic
1063138394 10:3236573-3236595 GAAGGGAAAGTGATGGGGTCAGG - Intergenic
1063663543 10:8049269-8049291 AATGGGAAGATGATGGAGGCGGG - Intergenic
1064321224 10:14306796-14306818 AAAGGTAAAATGATTTGTCCAGG + Intronic
1064424825 10:15221379-15221401 ACAGGCAGCATGATGGGGGCTGG + Intronic
1064735685 10:18379672-18379694 AAATGTAGAATGGTGGGTGCTGG - Intronic
1064840916 10:19591101-19591123 AAAGGCAAAATTATGGAGACAGG - Intronic
1065290551 10:24225118-24225140 AAAAGTCAAATGATTGGGCCAGG - Intronic
1065916755 10:30359548-30359570 AAAGGAAGGATGGTGGGGGCTGG - Intronic
1066044905 10:31586469-31586491 AAAGGCTAAATGAAGGTGGCAGG - Intergenic
1069568607 10:69480264-69480286 AATGGGAACAGGATGGGGGCAGG + Intronic
1070832556 10:79428331-79428353 GAAGGTAAAATGGTGGTTGCTGG + Intronic
1070840115 10:79479939-79479961 AATTTTAAAATAATGGGGGCAGG + Intergenic
1071155817 10:82687710-82687732 AAATGTAATATGGTGGGGGGAGG + Intronic
1072154088 10:92707987-92708009 AAATGTAAAATAATGAGGGGTGG - Intergenic
1072213742 10:93270939-93270961 AAATGTAAAGAGATGAGGGCTGG + Intergenic
1072583353 10:96759545-96759567 GAAGGGAAAAGGAAGGGGGCAGG + Intergenic
1072677174 10:97476558-97476580 AAATATAAAATAATGAGGGCGGG + Intronic
1073367119 10:102952266-102952288 AAATGTTAAATGATGGGGGCCGG + Intronic
1074120032 10:110487400-110487422 AATGGTAAAAAGGTGGGGGCGGG - Intergenic
1074186067 10:111100378-111100400 AAAGGTACAATAATGGGGACAGG + Intergenic
1074261652 10:111859856-111859878 AAAGGAAAAATAATCAGGGCAGG - Intergenic
1074384093 10:113003530-113003552 AAAGATAACATGATGCGGGCTGG - Intronic
1074457086 10:113604560-113604582 AAAGGAGAAAGGCTGGGGGCTGG + Intronic
1074592272 10:114823792-114823814 AAGGTTAAAATGATTCGGGCCGG - Intronic
1074602351 10:114927867-114927889 AATGTAAAATTGATGGGGGCGGG - Intergenic
1077437820 11:2551306-2551328 AAAGGCAAAACCATGGGGACAGG - Intronic
1077808770 11:5616244-5616266 AAAAGTAAAAAGATGAGGCCGGG - Intronic
1078907015 11:15697099-15697121 AACTGGAAAATGATGGGGCCAGG + Intergenic
1078932952 11:15927133-15927155 AAAGCTAAAAGTCTGGGGGCAGG + Intergenic
1079147137 11:17862877-17862899 TAAGACAAAAGGATGGGGGCTGG + Intronic
1081059804 11:38460568-38460590 AAAGGTTAAATGTTGATGGCTGG + Intergenic
1081884578 11:46483902-46483924 AAAGGTAAAAAGAAGGAGGTAGG + Intronic
1083564361 11:63700590-63700612 AAAATAAAAAGGATGGGGGCAGG - Intronic
1083836742 11:65274382-65274404 AAAGGGAAAAAGATTGGGTCAGG + Intronic
1084996671 11:72986503-72986525 AAAAGTAAAATAATTGGGGCCGG - Intronic
1085133047 11:74058640-74058662 AAATGTAAAATACTGGGTGCTGG + Intronic
1087009263 11:93498316-93498338 AAAGGACAAAGGTTGGGGGCAGG + Intronic
1087563318 11:99819259-99819281 AAAGGAAAAATGATGGCAGAAGG - Intronic
1087694744 11:101363807-101363829 AAACTTACAATGATGGGGGAAGG - Intergenic
1088033247 11:105277837-105277859 AAAGATAAAATGTTGGGGTGGGG + Intergenic
1088127533 11:106446978-106447000 AGAGATAAAATGATGGTGGAGGG + Intergenic
1088306237 11:108411003-108411025 GAAAGTAAAAGGAAGGGGGCCGG - Intronic
1088895887 11:114077988-114078010 AAAGATAAACTGTTGGGGTCAGG + Intronic
1089278787 11:117357914-117357936 AAAGGTAGAATGATAGGGCAAGG - Intronic
1089674079 11:120078138-120078160 AAAAGTAAAATTATGGGGCCGGG - Intergenic
1090974645 11:131671056-131671078 AGAAGAAAGATGATGGGGGCAGG - Intronic
1091137164 11:133202289-133202311 AGAGGGAAAATGATGGAGGATGG - Intronic
1091462379 12:654227-654249 AAAAGTAAATGGATGGGGTCAGG + Intronic
1091496687 12:979142-979164 TAAGGTTAAATGATGCGGCCAGG + Intronic
1092172281 12:6381462-6381484 AGAGATAAAGTGATGGGGCCAGG + Intronic
1092240648 12:6834121-6834143 ACAGGCAGAATGAAGGGGGCAGG - Intronic
1092940252 12:13401355-13401377 AAAGGTGATGTGCTGGGGGCGGG + Intergenic
1093037149 12:14342836-14342858 CAAGGTATAATGATGTGGGCAGG + Intergenic
1093836200 12:23832030-23832052 AAAAGTAAAGTGATGGGGCAGGG + Intronic
1094462609 12:30713400-30713422 AAAGTTAAAATCATGGGCTCTGG + Intronic
1095232983 12:39764100-39764122 AATGGTAAAAAGATGTAGGCAGG - Intronic
1095928963 12:47607014-47607036 GAAGATTAAATCATGGGGGCGGG - Intergenic
1097513830 12:60577813-60577835 AAAGGTTAATTAATGGAGGCAGG - Intergenic
1097971582 12:65638823-65638845 AAATGTACAATCATGGTGGCAGG - Intergenic
1098129224 12:67331337-67331359 AAAGGTAAAATGTGGCGGGTAGG - Intergenic
1098669196 12:73203288-73203310 AGACGAAAAATGATGGGAGCAGG - Intergenic
1098812045 12:75107006-75107028 AAAAGTAATATCATGGGGGCTGG + Intronic
1099076159 12:78112477-78112499 AAAGTTATAATCATGGGGGAAGG + Intronic
1100630307 12:96382105-96382127 AAATGCAAAATGGTGTGGGCGGG + Intronic
1101148159 12:101861320-101861342 AAAGATATAAAGATGTGGGCGGG + Intergenic
1101894103 12:108742048-108742070 GAAAGTAAAAGGATGGTGGCTGG - Intergenic
1102425537 12:112841290-112841312 ATAGTTAAGATGAGGGGGGCAGG + Intronic
1102809235 12:115809620-115809642 ACAGGTATAATGATGGGGGAGGG - Intergenic
1105531205 13:21222122-21222144 AAAGGGAAAAATATGGGGGAGGG - Intergenic
1106300699 13:28462022-28462044 AAAAGCAAAATGATGGGGCTGGG - Intronic
1107513826 13:41109923-41109945 AAACGTAAAATCATGGTGGAAGG - Intergenic
1108317393 13:49250014-49250036 AGAGGTAAAATGAGGGGGGTGGG + Intronic
1108992845 13:56684956-56684978 AAAGGTAAATTGATAGAGGCTGG - Intergenic
1109684788 13:65804137-65804159 AAATGTAAAATGAGTGGGCCGGG + Intergenic
1110535252 13:76643603-76643625 AAAAGTAATAGGATGGGGCCAGG - Intergenic
1110794912 13:79624787-79624809 AGGGGTAAAAGAATGGGGGCAGG + Intergenic
1111089651 13:83427037-83427059 AAATGTACAATCATGGGGGAAGG + Intergenic
1113322116 13:109244125-109244147 AAATGTAAAATGGAGTGGGCTGG + Intergenic
1114528968 14:23383379-23383401 AAGAGTAAAATGATGGAGGAGGG - Intronic
1115681740 14:35746893-35746915 AAAGGAAAAGGAATGGGGGCTGG + Intronic
1116303644 14:43218690-43218712 AGAGGTTGAATAATGGGGGCAGG - Intergenic
1117794320 14:59376623-59376645 AAAGGTAAAACTAGGGAGGCAGG + Intergenic
1118158345 14:63263689-63263711 TAAGGCAAAATGGTGGGGGAAGG - Intronic
1118190335 14:63574383-63574405 AAAAGTAAAATTTTGGGGCCAGG + Intergenic
1119579287 14:75762097-75762119 AAAAAAAAAATGTTGGGGGCTGG + Intronic
1120128284 14:80773047-80773069 AAAAGTAAAATGAGGGTGGCAGG + Intronic
1120195243 14:81474970-81474992 AAAGGAAAAATGAGGGTGGATGG + Exonic
1120680084 14:87470832-87470854 CAAGGAAAAATGTTGGGGGAAGG - Intergenic
1121073485 14:91046438-91046460 ATAGGTAAAATCATGGGAGTGGG + Intronic
1121385217 14:93515048-93515070 AAAGATGAAATGGTGGGGGACGG - Intronic
1121385424 14:93517678-93517700 AAAGATGAAATGGTGGGGGATGG - Intronic
1121561570 14:94880098-94880120 AAATGAAAAGTGTTGGGGGCAGG + Intergenic
1122311149 14:100795740-100795762 AAAAGTAAAAGGATGAGGCCAGG + Intergenic
1122385662 14:101344398-101344420 GAAAGTAAAAAGATGGGGGAAGG + Intergenic
1124113398 15:26814884-26814906 AAAGGCAAAATGATGGAGACAGG + Intronic
1124616106 15:31243379-31243401 AAATCAAAAATGATGGGGCCAGG - Intergenic
1125332297 15:38594105-38594127 AAAGAGAAAAGGATGGGGGGCGG + Intergenic
1127871582 15:63078305-63078327 TAATGTAAACTGCTGGGGGCTGG + Intergenic
1128811444 15:70575796-70575818 AAAGTTTATATGATGGGGGGAGG + Intergenic
1130726305 15:86442964-86442986 GAAGTAAAAGTGATGGGGGCAGG + Intronic
1130845011 15:87735919-87735941 AAAGGAAAATTACTGGGGGCGGG + Intergenic
1130942067 15:88519099-88519121 AAAGGTAAAATGATGGGGGCTGG + Intronic
1132404180 15:101532400-101532422 GAAAGTAGAATGGTGGGGGCCGG - Intergenic
1133005567 16:2879657-2879679 ACAGTGAAAATGATGGCGGCAGG + Intergenic
1133748149 16:8702901-8702923 ACAGGGGAAATGATGGAGGCAGG + Intronic
1133780630 16:8936304-8936326 CAAGGTGAACTGATGGGGGCGGG - Intronic
1134326629 16:13213629-13213651 CAAGGTTAATTAATGGGGGCGGG + Intronic
1134782780 16:16913763-16913785 AAAGGCAAAACTATGGGGGCAGG + Intergenic
1134861409 16:17563766-17563788 AAAGGGAGAAAGATGGAGGCTGG + Intergenic
1135112649 16:19702694-19702716 AAAATAAAAATGATGGGGCCTGG + Exonic
1135892632 16:26371424-26371446 AAAGATAAAATGAGGAGGGAAGG + Intergenic
1138568822 16:57854330-57854352 AAAAGTATAAAGATGGGGCCAGG + Intronic
1139926577 16:70491217-70491239 GAAGGTAAAATGATTTGGCCAGG + Intronic
1140465298 16:75176459-75176481 AAAGGTTAAATAATAGGGCCAGG + Intergenic
1140888056 16:79261752-79261774 GATGGGAAAATGATGAGGGCAGG + Intergenic
1141321022 16:83008894-83008916 AAAGGTAGAATTATGGTGGAAGG + Intronic
1143044373 17:4064865-4064887 AAAGTTAAAATTATGGGGGAGGG + Intronic
1143280894 17:5753371-5753393 TGAAATAAAATGATGGGGGCCGG - Intergenic
1143913487 17:10271718-10271740 AAAGGTAAAAAGATGCAGGCTGG + Intergenic
1144237770 17:13278664-13278686 AGAGGTAAAATGATGGAGGCAGG + Intergenic
1144954817 17:19013729-19013751 ACAGGGAAAATGCTGGGTGCAGG + Intronic
1145786241 17:27595684-27595706 AAAGGGAGAATGTGGGGGGCAGG - Intronic
1146069195 17:29664083-29664105 AAAGTAAAAAAGATTGGGGCTGG + Intronic
1147180334 17:38680694-38680716 AAAGGTTAAATGATGGTGGCTGG - Intergenic
1147711931 17:42473604-42473626 AAAGGGAAAAAAATGGGGACAGG - Intronic
1147908714 17:43841576-43841598 ACAGGGAAAATGATGGAGGAGGG - Intergenic
1148576905 17:48718818-48718840 AAAGGCAAATTGGTGGGGACGGG + Intergenic
1149832239 17:59882591-59882613 AAAGGAAAAAAGATGTGGGATGG - Intronic
1150499538 17:65637424-65637446 AAAGCCACAATGATGGGGGTGGG - Intronic
1150736649 17:67745842-67745864 AAAGATAAAAAGGTGGGGCCGGG - Intergenic
1151096307 17:71503156-71503178 TAAGGAAAAATGAAGGGGGCAGG - Intergenic
1151920093 17:77148168-77148190 AAAGGGAAAATGAAGGAGGCGGG + Intronic
1152609237 17:81307485-81307507 AAAGGGAAAGTGAAGGGGGAGGG - Intergenic
1153725987 18:7955618-7955640 ATAGGAAAAAGGGTGGGGGCAGG - Intronic
1154032402 18:10765380-10765402 AAAGGTGAAGTGGTGTGGGCTGG + Intronic
1155410669 18:25541361-25541383 AAAGGCAAAATGATATGGGTAGG + Intergenic
1156006223 18:32445138-32445160 AAAAGTAAGATGATGAGGTCAGG - Intronic
1156798388 18:41076882-41076904 AAAGTTAAAATGCTAGTGGCAGG + Intergenic
1157189218 18:45566726-45566748 AAAGGAAAACTCTTGGGGGCAGG + Intronic
1157209217 18:45727168-45727190 AAAGGCAAGCTGAGGGGGGCTGG - Exonic
1158290201 18:55932279-55932301 ATTGGTAAAATGATAGAGGCAGG + Intergenic
1159993064 18:74933375-74933397 GAAGGTAGAATGTTGGGTGCCGG + Intronic
1161188956 19:2942517-2942539 AAATGTAAAATAATGAGGCCGGG - Intronic
1161449429 19:4336607-4336629 AAAAGAAAGATAATGGGGGCCGG - Intronic
1161674819 19:5639794-5639816 AAACTTCAAATGATGGGGGATGG + Intronic
1161864374 19:6822614-6822636 AAAGGAAAAGCGATGGGAGCAGG - Intronic
1162037313 19:7948314-7948336 GAAGGTGAAATGATGGCAGCTGG + Intergenic
1162429027 19:10615866-10615888 AAAGATGAAATGAGGCGGGCTGG + Intronic
1163172742 19:15543867-15543889 AAAAAAAAAAAGATGGGGGCGGG + Intronic
1163213111 19:15856475-15856497 GAAGCTGAAATGATGGAGGCGGG - Intergenic
1163728568 19:18936692-18936714 AAAGGTAAATTGTTGGGGCCGGG + Intronic
1164530713 19:29046263-29046285 TAAGGGAAAATGGTGGGGGTGGG - Intergenic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166192227 19:41182666-41182688 AAAGGTAAAAAAAGGGGGACAGG + Intergenic
1166854492 19:45776753-45776775 CAAGAAAAAATGATGGGGCCAGG - Intronic
1167215783 19:48163646-48163668 AAATATAAAATGTTGGGGCCTGG + Intronic
1167326829 19:48831781-48831803 AGAGGAAAAGTGACGGGGGCTGG + Intronic
1167835425 19:52064558-52064580 AAGGTTAAAATGATGGTGGGAGG + Exonic
1168304469 19:55427995-55428017 AAAGGTAAAAAGGAGGTGGCAGG - Intergenic
1168600043 19:57709981-57710003 AAATGTAATATGATAGAGGCTGG - Intronic
926117174 2:10220918-10220940 AAAGGCAGAATGCTGGGTGCCGG + Intergenic
926741574 2:16115670-16115692 AAATGTAGTCTGATGGGGGCTGG + Intergenic
927068169 2:19494770-19494792 ACAGGTAAAATGCTGAGGTCAGG - Intergenic
927887862 2:26729537-26729559 AAAGGCAAAGGGGTGGGGGCTGG + Exonic
928011542 2:27612826-27612848 AATGACACAATGATGGGGGCAGG - Intronic
928247442 2:29643201-29643223 AAAGTTAAAATGATATGGGCAGG + Intronic
928286601 2:29995455-29995477 AAAGGAGAAGAGATGGGGGCAGG + Intergenic
928671803 2:33610428-33610450 CAAGGTAGAATGAGAGGGGCTGG + Intergenic
929906142 2:46048395-46048417 CATGGGAAATTGATGGGGGCTGG - Intronic
930443146 2:51434605-51434627 AAAAGTAAAGGGATGGAGGCTGG + Intergenic
930712156 2:54559235-54559257 AGAGGTAAGAGGCTGGGGGCTGG - Intronic
930769849 2:55120258-55120280 AGAGCTAAAGTGAGGGGGGCAGG - Intergenic
931329393 2:61264337-61264359 AAAGATAACATGATGAGGCCAGG + Intronic
931415725 2:62078571-62078593 AAAGAAAAAATGGTGGGGCCAGG + Intronic
932248498 2:70218886-70218908 AAGGCCAAAATAATGGGGGCTGG + Intronic
932333972 2:70918906-70918928 TAAAGTAAAATGATGGAGGCGGG + Intronic
932531537 2:72539196-72539218 AAAGGAAAAAAGAAGGGGGAGGG + Intronic
932776516 2:74531125-74531147 AAATGACAAATGATGGGGGAGGG + Intronic
933082264 2:78005596-78005618 AAAAAAAAAAAGATGGGGGCTGG - Intergenic
935263436 2:101374817-101374839 ATAGTTAAAAAGATGGAGGCTGG + Intronic
935521042 2:104105453-104105475 CAAAGTAAATAGATGGGGGCAGG + Intergenic
936028647 2:109053833-109053855 AAAGGGAACTTGATGGGGGAGGG - Intergenic
937194234 2:120136073-120136095 AAAGTTAAAAAGCTGGGGGTGGG + Intronic
938236970 2:129713047-129713069 GAAGGGTAAATGATGGGGTCAGG - Intergenic
940044990 2:149400398-149400420 AACGATAAAAGGATGGGGGCAGG + Intronic
941833476 2:169989379-169989401 AAAAGTAAAATGATGGGAGGAGG - Intronic
942140417 2:172972071-172972093 AAAGGCAAAATACTGTGGGCGGG + Intronic
942215193 2:173712582-173712604 TCAGGTGCAATGATGGGGGCAGG + Intergenic
942931213 2:181495458-181495480 AATTGTAAAATGATGGGAGGTGG + Intronic
943911829 2:193578954-193578976 AAAATTAAAATTGTGGGGGCCGG + Intergenic
943958663 2:194229776-194229798 AAAGGCAAAATTATAGGGTCAGG + Intergenic
945588282 2:211694869-211694891 AAAGGTGAAAGTATGGGAGCAGG + Intronic
947075723 2:226342667-226342689 AAAGGTAAATTAATGGGGAAAGG + Intergenic
947223976 2:227822508-227822530 AAAGGAAAGGAGATGGGGGCTGG - Intergenic
947941201 2:234057152-234057174 CAAGGTAAACAGATTGGGGCAGG - Intronic
1168858805 20:1029943-1029965 AATGGTAGAATGTCGGGGGCTGG + Intergenic
1168972770 20:1942123-1942145 AATGGGCATATGATGGGGGCTGG + Intergenic
1169390941 20:5190555-5190577 ACAGTTCAATTGATGGGGGCTGG - Exonic
1169483604 20:6006961-6006983 AAAGGTCAAATGATGGTGAACGG - Intronic
1170448073 20:16450881-16450903 AACAGTAAAATGATGTGAGCAGG + Intronic
1170900389 20:20456784-20456806 AAAGGCAAAATGGTGGAGGGAGG - Intronic
1172452401 20:35036184-35036206 GAAGGTTAAATGATGGAGTCAGG - Intronic
1173434309 20:43018565-43018587 AAATGTAAAATGGCGGGGGGTGG + Intronic
1173740073 20:45394197-45394219 ATAGGTAAACTAATGGTGGCAGG + Intronic
1173989918 20:47293991-47294013 AAACTTAAAATGATGGTGGAAGG - Intronic
1174478329 20:50813267-50813289 AAATGGAAAATGATGAGGGCTGG - Intronic
1177022246 21:15876491-15876513 AAACTTAAAATGATGGCGGAAGG + Intronic
1177839954 21:26224619-26224641 AAAGTTAAAATGATGGTGTCAGG - Intergenic
1178050605 21:28742681-28742703 AAAGGAAAAAAAATGGGGGAGGG + Intergenic
1178399253 21:32270100-32270122 AAAAATAAAAAGCTGGGGGCAGG + Intronic
1178857426 21:36261913-36261935 AAAGGAAAAAAAATGGGGGTGGG + Intronic
1179837024 21:44042006-44042028 TAAGAAATAATGATGGGGGCTGG - Intronic
1179926167 21:44535043-44535065 AAAGGTAGAATGGTAGGTGCCGG + Intronic
1182418435 22:30236322-30236344 GAAGGCAACATGATTGGGGCAGG - Intergenic
1185255856 22:49830813-49830835 AAAAATAAAACGATGGGGCCAGG + Intergenic
1203238073 22_KI270732v1_random:26673-26695 AAAAGTAAAAAGATGGAGGAGGG - Intergenic
949129705 3:485126-485148 AATGGTAAAATGAAGTGAGCAGG - Intergenic
949187294 3:1207383-1207405 TAAGGGAAAATAATGGTGGCTGG - Intronic
949828092 3:8184306-8184328 AAAACTATAATGATGGGGACAGG - Intergenic
949991989 3:9587010-9587032 AAATGTAAATAAATGGGGGCTGG - Intergenic
951430712 3:22603745-22603767 AATGGTAAAATAAGGAGGGCTGG - Intergenic
951824068 3:26847568-26847590 AAAGGTAGAATGATGGAGTGAGG - Intergenic
951929576 3:27950058-27950080 AAAGTTAAAAAGTTGGGGGATGG - Intergenic
953299728 3:41761037-41761059 AAAGATAAAACTATAGGGGCAGG + Intronic
953479264 3:43235762-43235784 AAAAGTAGAATGATGGTTGCTGG - Intergenic
954584260 3:51720261-51720283 GAAGGGGAAATGAGGGGGGCAGG - Intergenic
954596925 3:51833313-51833335 AACTCTAAAATGCTGGGGGCTGG - Intergenic
955107981 3:55918305-55918327 AAAAATAAAAAGGTGGGGGCAGG + Intronic
955337860 3:58101910-58101932 AAAGGTTAAATGCTGGAAGCAGG + Intronic
956004870 3:64768148-64768170 AAAAGGAAAATGATGGAGTCTGG - Intergenic
956180835 3:66517068-66517090 AAAGGGAAAATAGTGGGTGCAGG + Intergenic
957501420 3:81062911-81062933 CAAGGTAAAAATATGTGGGCTGG - Intergenic
958665313 3:97129202-97129224 AAAGGTACAGTGGTGGGGCCAGG + Intronic
959302573 3:104621723-104621745 TAAGCAAAAATGTTGGGGGCAGG - Intergenic
959426899 3:106201456-106201478 AAAGTTAAAATCATGGTGGAAGG - Intergenic
959477411 3:106827873-106827895 AAAGGTCAAGAGATGGGGGAAGG - Intergenic
959636841 3:108584410-108584432 AAAGCTGAAAAGATGAGGGCTGG + Intronic
959995553 3:112676680-112676702 AAAGAGAAAATGATGGAAGCAGG + Intergenic
960111951 3:113853857-113853879 GAGGCTTAAATGATGGGGGCGGG + Intronic
960208832 3:114935303-114935325 AAAGGTAACATGGTGGGGAAGGG - Intronic
960272887 3:115693768-115693790 TAAAATAAAATGATGGGGGCTGG + Intronic
960884322 3:122379138-122379160 GGAGGTAAAATGATTGGGGAAGG + Intronic
962278102 3:134030558-134030580 CAAGGTGAAAAGGTGGGGGCTGG + Intronic
963939584 3:151085933-151085955 ACAGGTAAAGTGTTGGGGGTTGG + Intronic
964909946 3:161768248-161768270 AAAGGTAAAATTTTGATGGCTGG + Intergenic
965518158 3:169644551-169644573 AAATATAAAATGGTAGGGGCCGG - Intronic
966496049 3:180582009-180582031 AAAGGTAAAACTATGAGGACAGG + Intergenic
966842025 3:184097602-184097624 AAAGGAGCAATGATGGGGGAAGG + Intronic
966877272 3:184329814-184329836 AAAGGTAAAGAGATGGGGAAAGG + Intronic
967366192 3:188688919-188688941 AAAGTTAAAATAATAGAGGCGGG - Intronic
969115977 4:4871136-4871158 AAAAGTAACAAGACGGGGGCAGG + Intergenic
970355320 4:15245396-15245418 AGAGAGAAAATGATGGGAGCTGG + Intergenic
971645075 4:29189019-29189041 AAAAGTAAAAAGAAGGGAGCCGG - Intergenic
971780986 4:31034197-31034219 AAAGGGAAGATGATGGAGGCAGG - Intronic
971816736 4:31500604-31500626 AAAGATATAAGGATGGGGGACGG - Intergenic
972633532 4:40862548-40862570 ACAGTTAAAATGATGGTGCCGGG + Intronic
974036431 4:56821884-56821906 AAAGGTAGAAGGACGGGGGAGGG + Intergenic
974078345 4:57188377-57188399 AAAGGGAAGCTGATGGGTGCAGG - Intergenic
974512727 4:62866020-62866042 AAAAGTAATATATTGGGGGCCGG - Intergenic
974916702 4:68186641-68186663 AAAGGCAAGGAGATGGGGGCAGG + Intergenic
975662241 4:76699363-76699385 AAAGGTAAAAAGCAGGGGGAGGG - Intronic
975988603 4:80232508-80232530 AAAGGGAAAAGAATTGGGGCTGG - Intergenic
976205233 4:82617877-82617899 ATAGGTAAAAAGATGGGGGAAGG - Intergenic
976465239 4:85360262-85360284 CAAGGTAAAATGAAGGTAGCTGG - Intergenic
978268555 4:106859031-106859053 AAAGGTAAGGGGATGGGGGAGGG + Intergenic
978503979 4:109436856-109436878 ACAGGGCAAAGGATGGGGGCAGG - Intronic
978507433 4:109474719-109474741 AAAGAAAATATGATAGGGGCTGG - Intronic
978638570 4:110841392-110841414 AAAGATAAGAAGATGAGGGCCGG - Intergenic
978761852 4:112361602-112361624 AAAGGTCATCAGATGGGGGCAGG - Intronic
978903525 4:113980175-113980197 AATAGGAAAATGATGGGGGTGGG - Intergenic
980853405 4:138410994-138411016 AAAAATAAAATGGTGGGGCCGGG - Intergenic
980973403 4:139587926-139587948 AAAGATAGAATGCTGGGGGTGGG + Intronic
981281048 4:142958992-142959014 AAAGGTAAAATGAAGCGAGCAGG + Intergenic
981633118 4:146844675-146844697 AAAGGTTAAGGGCTGGGGGCTGG - Intronic
983013276 4:162577109-162577131 AAATCAAAGATGATGGGGGCAGG + Intergenic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
983962477 4:173771204-173771226 AAAGGGAAAGTGATGGGATCAGG + Intergenic
984001430 4:174251461-174251483 AAAGGGAAAAGGAGGGTGGCTGG + Intronic
986466916 5:8034932-8034954 AAAGGAAGAATGGTGGGGACAGG + Intergenic
986470891 5:8073189-8073211 AAACGTACAATCATGGGGGAAGG + Intergenic
987318206 5:16743923-16743945 AAAGGGAAAATGGTGGTGGAGGG + Intronic
987794475 5:22608604-22608626 AAAGGTAAAATGATATGGTTTGG + Intronic
987934104 5:24441664-24441686 AAAGGTGAAATGTATGGGGCAGG + Intergenic
988351852 5:30118724-30118746 AAAGGAATAAGGATGGGGTCTGG - Intergenic
988509971 5:31856431-31856453 AAAGGGAAAGTGATGGGGTTCGG + Intronic
988937656 5:36104335-36104357 AGATGTAAAAAGAAGGGGGCAGG + Intronic
989677561 5:43989536-43989558 AAAGGAAAAATTATGGGTGTTGG - Intergenic
990195894 5:53315997-53316019 AAAAGTAAAAGGATGAAGGCTGG + Intergenic
990527442 5:56641852-56641874 AAAGGTTAAGTGCTAGGGGCGGG - Intergenic
990687125 5:58317159-58317181 AAAGGGAACATGATGGATGCTGG + Intergenic
990833710 5:59990436-59990458 AAAGGTAAAAGGATGTGAGATGG + Intronic
991035392 5:62123005-62123027 AAAGGAAAAAGACTGGGGGCAGG + Intergenic
991452966 5:66772200-66772222 AAAGGTAAGAAGATGGTGGGTGG + Intronic
991563159 5:67976493-67976515 AAGGAGAAAATGATGGGGACAGG - Intergenic
992240859 5:74767724-74767746 AGCAGTAAAATGAAGGGGGCGGG - Intronic
993167534 5:84376715-84376737 ACAGGCAAACTGATGGGGGTGGG + Intronic
993323908 5:86510606-86510628 AAAGATGAAATGATGGAGGTCGG + Intergenic
993350279 5:86842082-86842104 AAAGGTCAAGTTATGGGGGCCGG + Intergenic
993871154 5:93256062-93256084 ACAAGTCAAATGATGAGGGCAGG - Intergenic
994539013 5:101070996-101071018 AAACTTAAAATGATGGTGGAGGG + Intergenic
996882352 5:128313952-128313974 AAAGGGATAATGATGGTGGCTGG - Intronic
997572475 5:134941820-134941842 AAAAATAAGATTATGGGGGCTGG + Intronic
998312099 5:141143933-141143955 AAAGTTATAATAATGGGGCCGGG + Intronic
998549486 5:143063663-143063685 AAAGGTAAAAGGATGGAGCAGGG - Intronic
999391159 5:151192203-151192225 AATGGTAAAATAAGGGGGGTGGG + Intronic
999970929 5:156861895-156861917 AAAAGTAAAAAGATGGGTGAAGG + Intergenic
1000797415 5:165682339-165682361 AAAAGAAAAATGAGGGGGGAGGG + Intergenic
1001027003 5:168232816-168232838 AAATGTAAGATGATGGCGGATGG + Intronic
1002255288 5:177953862-177953884 AAGAGTAAAAAGATGGGGCCGGG + Intergenic
1002788249 6:419885-419907 GAAAGTAGAATGGTGGGGGCTGG - Intergenic
1003305823 6:4927214-4927236 AAAGGTAGAATTATAAGGGCAGG + Intronic
1003397582 6:5766287-5766309 AAGGGTAAGAGCATGGGGGCCGG - Intronic
1005830085 6:29663716-29663738 AAAGGAAAAATGTGGGGGGTTGG + Intronic
1007843326 6:44734516-44734538 TGAGGTGAAATGTTGGGGGCTGG - Intergenic
1007843921 6:44738634-44738656 CAGGGTAAAAAGATGGGGCCTGG + Intergenic
1011750873 6:90453512-90453534 CAAAGTAAAATGGTGGGAGCTGG + Intergenic
1011808659 6:91103261-91103283 AAATGACAAATGGTGGGGGCAGG + Intergenic
1012081641 6:94765603-94765625 AAAGATAAAAGGATAAGGGCAGG + Intergenic
1012134863 6:95543244-95543266 AAACTTAAAATCATGGTGGCAGG + Intergenic
1012695257 6:102373589-102373611 AAAGTTACAATCATGGGGGAAGG - Intergenic
1013858212 6:114601588-114601610 CAAGGTAAATTGAGGGAGGCAGG + Intergenic
1014450934 6:121580794-121580816 CAAGTTAACATGATGGAGGCTGG - Intergenic
1014646734 6:123982988-123983010 AAAGGAAAAAGGTTGGGGGCGGG - Intronic
1014683857 6:124470069-124470091 AAAGTTAGCAAGATGGGGGCAGG + Intronic
1014844348 6:126257781-126257803 AAATGGAAAACGAAGGGGGCAGG + Intergenic
1014973794 6:127852830-127852852 AAAGGTAAAGTGATTGGCACTGG - Intronic
1015268843 6:131318094-131318116 AAAAGGAAAATGAAGGTGGCTGG - Intergenic
1016967163 6:149729619-149729641 AAAGGTAATAGGAGGGGTGCTGG - Intronic
1017629175 6:156379595-156379617 AAAGCTAAAATTATCGTGGCTGG - Intergenic
1017923558 6:158891516-158891538 AAAAATAAAAGGATGGAGGCTGG - Intronic
1018040364 6:159916309-159916331 GAAGGTAGAATGGTGGTGGCCGG + Exonic
1018128751 6:160707464-160707486 AAAGGGAAAATTATGAGGGAGGG + Intronic
1018675483 6:166218456-166218478 AAAGGCAAAATTATGGTTGCCGG + Intergenic
1019193229 6:170266369-170266391 AGAGGTCAAAGGTTGGGGGCTGG + Intergenic
1020664015 7:11016871-11016893 AAGGGTGAAATGGTGGGGGGAGG - Intronic
1021034441 7:15780181-15780203 AAAAGTAAAATTATTGGGCCAGG - Intergenic
1021531573 7:21652353-21652375 AAAGGTAAAATGTTGATGGCCGG + Intronic
1022339920 7:29458511-29458533 AGAAGTAAAAAGTTGGGGGCAGG - Intronic
1022545146 7:31180328-31180350 AAAGGTAAGGTGGAGGGGGCAGG - Intergenic
1022559667 7:31335805-31335827 CAAGGGAGAAAGATGGGGGCGGG + Intergenic
1022721970 7:32949462-32949484 GAAAGTAAAAAGGTGGGGGCAGG + Intergenic
1025206765 7:56997663-56997685 AAAAGAAAAAAAATGGGGGCTGG + Intergenic
1025638272 7:63343488-63343510 AAAAATAAAATGATGGAGGGGGG - Intergenic
1025644424 7:63404601-63404623 AAAAATAAAATGATGGAGGGGGG + Intergenic
1025665175 7:63579263-63579285 AAAGAAAAAAGAATGGGGGCTGG - Intergenic
1026781080 7:73267896-73267918 AAAGGACAAATGAGAGGGGCAGG - Intergenic
1027021934 7:74821338-74821360 AAAGGACAAATGAGAGGGGCAGG - Intronic
1027024085 7:74838048-74838070 AAATGTAAAAGGCTGGGTGCGGG - Intronic
1027063845 7:75107273-75107295 AAATGTAAAAGGCTGGGTGCGGG + Intronic
1027066087 7:75124579-75124601 AAAGGACAAATGAGAGGGGCAGG + Intronic
1027434600 7:78151522-78151544 AAATGTAAGATGACCGGGGCTGG + Intronic
1027497387 7:78905058-78905080 ATATGTAAAATGATGGGGAGAGG - Intronic
1028427010 7:90700671-90700693 ATAAGTAAAATGCTGGGGGTTGG - Intronic
1028829845 7:95315023-95315045 AAAGCTATAATGATCAGGGCTGG + Intronic
1030098771 7:105925851-105925873 AAAGGCAAAACGATGGAGACAGG - Intronic
1030178137 7:106676019-106676041 AAAGTTAAAAAAAAGGGGGCTGG + Intergenic
1030189206 7:106793971-106793993 AAAGGGAAAATGGTGGGGGGCGG + Intergenic
1031169447 7:118274112-118274134 AAAGTCAAAATGCTGGGGGATGG - Intergenic
1031262419 7:119537922-119537944 AAAGGTAATATTATGGAGACTGG + Intergenic
1031304625 7:120110731-120110753 TAAGTTAAAATATTGGGGGCTGG + Intergenic
1031532761 7:122895993-122896015 AAAGGGAAATTGATGGGGCCAGG - Intergenic
1031567422 7:123318132-123318154 AAGGGTATAATGAGGGGGGTGGG - Intergenic
1031680852 7:124673063-124673085 AAAGGTACAAGGAAGGAGGCAGG - Intergenic
1031750015 7:125560183-125560205 AAATGTAAAAGGATGGTGGCAGG - Intergenic
1032242139 7:130171038-130171060 AAAGGTAACATACTGGGGGGTGG + Intronic
1032562453 7:132906614-132906636 AAAAGGAAAAAGATTGGGGCGGG - Intronic
1032891649 7:136201125-136201147 AATGGAAAAATGAGGGGGCCAGG - Intergenic
1032992196 7:137405976-137405998 AAAGGTGAAAAGATGGGTGGGGG + Intronic
1033590174 7:142802229-142802251 ATAGGGCAGATGATGGGGGCAGG + Intergenic
1034745454 7:153519860-153519882 AAAGGCCAAAGGACGGGGGCTGG - Intergenic
1034956954 7:155340751-155340773 GAAGGTAGAATGGTGGGTGCTGG - Intergenic
1035387941 7:158486950-158486972 GAAGGTAGAGTGATGGGGCCAGG - Intronic
1036289421 8:7474126-7474148 AAGGGTAAAAAGATGGGTGCTGG + Intronic
1036332057 8:7837406-7837428 AAGGGCAAAAAGATGGGTGCTGG - Intronic
1037131906 8:15416779-15416801 CAAGGCAAAATGTTTGGGGCTGG + Intergenic
1037364931 8:18111814-18111836 AAAGTGAAAATGTTGGGGGATGG - Intergenic
1037856188 8:22372037-22372059 AAAGATAAAATAAAGGGGCCGGG - Intronic
1038407686 8:27334263-27334285 AATGGTAAATTTAAGGGGGCTGG - Intronic
1038851948 8:31287622-31287644 AAACTTAAAATGATGGTGGAAGG + Intergenic
1038998957 8:32958351-32958373 AGAGGGAAAAGGATGGGGGTGGG - Intergenic
1039032978 8:33329948-33329970 AAGGGTAAAATGATCTGGGGTGG - Intergenic
1039476064 8:37840002-37840024 AAAGTAAAAAAGCTGGGGGCCGG + Intronic
1041519973 8:58744941-58744963 AAAGGGCAAATGATGAGGGGAGG + Intergenic
1041990288 8:63980239-63980261 AAGGGAAAAAAGATGGGGGATGG - Intergenic
1042041181 8:64591890-64591912 AAAAATGAAAAGATGGGGGCGGG + Intronic
1042099155 8:65255543-65255565 AAAATTTAAATTATGGGGGCCGG + Intergenic
1042771270 8:72385282-72385304 ATAGGGGAAATAATGGGGGCAGG + Intergenic
1042838094 8:73095667-73095689 ATTGGTAAAATTATGGGGGTGGG + Intronic
1042952600 8:74217222-74217244 AAAGTTGAATTGATGGGAGCTGG + Intergenic
1044508980 8:93053461-93053483 AAAGGTATAAGGAAGGGGTCTGG + Intergenic
1045129035 8:99127438-99127460 AAAGGTAAAATAGTGGGGGTGGG - Intronic
1045272876 8:100676832-100676854 GAAGATAAAATGATGCAGGCAGG - Intergenic
1045984612 8:108235315-108235337 AGAAGTAAACTAATGGGGGCTGG + Intronic
1046190234 8:110785684-110785706 AAAGTAAAAATGTTGGGGGTGGG - Intergenic
1046430122 8:114113647-114113669 AAACGTAAAATCATGGCGGAAGG - Intergenic
1046645676 8:116782901-116782923 AGAGGTAAAATGATGGGTTTTGG + Intronic
1047536415 8:125724266-125724288 AAATGGAAAATGATGGGTTCAGG - Intergenic
1047540618 8:125762154-125762176 GAATGCAAAATGATGGGGGGAGG - Intergenic
1050146744 9:2576174-2576196 AATGGTTGAAAGATGGGGGCAGG + Intergenic
1050286913 9:4112973-4112995 ATAAATAAAATCATGGGGGCAGG - Intronic
1050479537 9:6075476-6075498 AAAAGTAAAAGAATGGAGGCAGG - Intergenic
1051034407 9:12725587-12725609 ATATATAAAATGATGGAGGCCGG - Intergenic
1051046376 9:12879965-12879987 AAAGGTAAAATGAAAGGGCAAGG - Intergenic
1051554214 9:18364767-18364789 AAAGTTACAATCATGGGGGAAGG + Intergenic
1051594739 9:18813258-18813280 AAAAGTACAAAGTTGGGGGCCGG - Intronic
1053377115 9:37616859-37616881 AGAGTTAGAATGAAGGGGGCTGG + Intronic
1053493119 9:38526547-38526569 GAATGTAAAATGATAGAGGCTGG + Intergenic
1054813300 9:69451779-69451801 AAAAGTTAAATGATGGTGCCAGG - Intronic
1055920811 9:81459068-81459090 AAATGTCAAATGGTGGGGGCAGG - Intergenic
1056514733 9:87339574-87339596 AAATTTAAAATGTTGGGGCCGGG - Intergenic
1056626973 9:88261695-88261717 AAATATAAAGTGATGGAGGCCGG - Intergenic
1056642316 9:88382143-88382165 AAGGGTCAGAGGATGGGGGCTGG + Intergenic
1056871330 9:90283176-90283198 AAAAGTAGAGTGATGGTGGCAGG + Intergenic
1057077395 9:92145675-92145697 ACAGCCAAAATGATGGAGGCAGG + Intergenic
1057646074 9:96876488-96876510 AAAGGCAAACTGATGGAGGGAGG - Intergenic
1057673354 9:97115457-97115479 GAATGTAAAATGATAGAGGCTGG + Intergenic
1057884808 9:98822233-98822255 AAAGTTTGAATGCTGGGGGCTGG - Intronic
1058082727 9:100716631-100716653 AAAGTTAGAATGCTAGGGGCTGG - Intergenic
1058348070 9:103988461-103988483 AAAGGTAGAATGAGGTGGGAGGG + Intergenic
1058672731 9:107374192-107374214 AAAGGTAGAATCAGGGGGACTGG + Intergenic
1058860696 9:109115391-109115413 AAAGGAAAATTGATGGGACCTGG + Intronic
1059057111 9:110995467-110995489 AATGGTAATATGCTGGGAGCAGG - Intronic
1060045839 9:120339585-120339607 CAATGCAAAATTATGGGGGCAGG + Intergenic
1060938934 9:127532305-127532327 AAAAGTAAAAAGATGGAGGGGGG + Intronic
1061049333 9:128185400-128185422 ATCTGTAAAATGAGGGGGGCGGG - Intronic
1061740809 9:132704423-132704445 AAAGTTAAATGGATGGAGGCTGG - Intergenic
1061792720 9:133066942-133066964 AAAGGTAAACGGAGGAGGGCAGG + Exonic
1062705465 9:137937647-137937669 AAAGTTAAGATGAAGGAGGCTGG + Intronic
1186615083 X:11177755-11177777 AAAAGTGGAATGATGGGGGTGGG - Intronic
1188465980 X:30481781-30481803 AAAAATAAAATCAAGGGGGCTGG + Intergenic
1188592399 X:31853714-31853736 AAAAAAAAAATGATGGGGACTGG + Intronic
1189189528 X:39088488-39088510 AAAACTACAATGATGGGGGGCGG + Intergenic
1189663916 X:43332724-43332746 AAAAGAAAAGTGATGTGGGCCGG - Intergenic
1190216484 X:48482429-48482451 AAAGGCACAATGATGCGGGTGGG - Exonic
1190410400 X:50131489-50131511 AAAGATAAAATAATGTGGCCGGG + Intergenic
1190561943 X:51694962-51694984 AAAGGGAAAAGGATGGGGAAGGG + Intergenic
1192882920 X:75306862-75306884 AAAAGTAAAAGGATGAGGCCAGG - Intergenic
1193378345 X:80788265-80788287 CAATTTAAAAAGATGGGGGCAGG + Intronic
1194164744 X:90501505-90501527 AAAGGGAAGATGGTGGGGGGCGG + Intergenic
1194205548 X:91007108-91007130 TAAGGTAAAATGGTGGTTGCCGG - Intergenic
1194358194 X:92915007-92915029 AAAGTTAAAAAGCTGGGGGTGGG - Intergenic
1195595094 X:106679857-106679879 AAAAGTAAAATGTTTGAGGCTGG + Intergenic
1196605778 X:117655567-117655589 AAATTTAAAATGATGGTGGAAGG + Intergenic
1196821823 X:119707695-119707717 AAATGTAAAAAGAAGGGAGCAGG - Intergenic
1197872348 X:131072084-131072106 AAAGGTAAGATGGTTTGGGCTGG + Intronic
1198655894 X:138913102-138913124 AAAAGTAAAATGATGCTGTCTGG - Intronic
1198737740 X:139806239-139806261 AAAGGTAAAAGGATAGGTACAGG + Intronic
1198760696 X:140029415-140029437 AAAGCTAACAGAATGGGGGCTGG - Intergenic
1198954973 X:142118793-142118815 AAAGAAAAAAAGATGGGGTCTGG + Intergenic
1199151000 X:144486461-144486483 AAAGGGAAAAAGGTGGGGGGGGG + Intergenic
1199342634 X:146699304-146699326 AAAAATAAAATGATGGGTACAGG + Intergenic
1199611591 X:149621208-149621230 AAAAGTAAATTGGTGGGGGGGGG + Intronic
1200511004 Y:4079299-4079321 AAAGGGAAGATGGTGGGGGGCGG + Intergenic
1201484348 Y:14476045-14476067 AAAGGAAAGAGGATGGGAGCAGG - Intergenic
1202169699 Y:22030121-22030143 AAAGGAAAAAAGATGTGGGTAGG - Intergenic
1202221667 Y:22556252-22556274 AAAGGAAAAAAGATGTGGGTAGG + Intergenic
1202321452 Y:23639422-23639444 AAAGGAAAAAAGATGTGGGTAGG - Intergenic
1202549315 Y:26030634-26030656 AAAGGAAAAAAGATGTGGGTAGG + Intergenic