ID: 1130955003

View in Genome Browser
Species Human (GRCh38)
Location 15:88621422-88621444
Sequence CGGGCTGAGGCCGCGTGTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130954996_1130955003 2 Left 1130954996 15:88621397-88621419 CCTGCACCGGGGCGGCGGGGTCG 0: 1
1: 0
2: 1
3: 18
4: 148
Right 1130955003 15:88621422-88621444 CGGGCTGAGGCCGCGTGTCCCGG 0: 1
1: 0
2: 0
3: 14
4: 121
1130954991_1130955003 9 Left 1130954991 15:88621390-88621412 CCAGGACCCTGCACCGGGGCGGC 0: 1
1: 0
2: 1
3: 27
4: 208
Right 1130955003 15:88621422-88621444 CGGGCTGAGGCCGCGTGTCCCGG 0: 1
1: 0
2: 0
3: 14
4: 121
1130955000_1130955003 -4 Left 1130955000 15:88621403-88621425 CCGGGGCGGCGGGGTCGGGCGGG 0: 1
1: 2
2: 10
3: 101
4: 659
Right 1130955003 15:88621422-88621444 CGGGCTGAGGCCGCGTGTCCCGG 0: 1
1: 0
2: 0
3: 14
4: 121
1130954995_1130955003 3 Left 1130954995 15:88621396-88621418 CCCTGCACCGGGGCGGCGGGGTC 0: 1
1: 0
2: 1
3: 12
4: 106
Right 1130955003 15:88621422-88621444 CGGGCTGAGGCCGCGTGTCCCGG 0: 1
1: 0
2: 0
3: 14
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130955003 Original CRISPR CGGGCTGAGGCCGCGTGTCC CGG Intronic
900251785 1:1674746-1674768 CGGGAGGAGGCCGAGGGTCCAGG - Intronic
900262193 1:1737602-1737624 CGGGAGGAGGCCGAGGGTCCAGG - Intronic
901323531 1:8353571-8353593 CAGGCTGAGGGCGGGTGTTCTGG - Exonic
901634375 1:10663781-10663803 CGGGCTGAGGGGGCGAGGCCTGG + Intronic
901636697 1:10673864-10673886 CGGGCTGAGGCCAGGCGCCCTGG + Intronic
903742967 1:25568970-25568992 CTGGGTGGGGCCGCGTGCCCAGG + Intergenic
907518911 1:55010572-55010594 CGGGTTGAGGCCGGGGGTCCTGG + Exonic
907667478 1:56446180-56446202 GGGGCTGAGGCCGGGTGTGGTGG - Intergenic
912686881 1:111774897-111774919 CCGGCTGAGGCTGCGAGCCCTGG + Intronic
916488405 1:165279606-165279628 GGGGCTGATGCTGCCTGTCCAGG + Intronic
919486873 1:198157158-198157180 GGGGCTGAGGCTGCGAGGCCCGG - Exonic
924384152 1:243487330-243487352 GGGGCTGAGGCAGCCTTTCCTGG - Intronic
1063929943 10:11018410-11018432 CGGGCGGGGTCCGCGAGTCCGGG + Intronic
1066435150 10:35390912-35390934 GGGCCTGAGGCCAAGTGTCCAGG + Intronic
1067347071 10:45444440-45444462 CAGGCTGAGGCCGGGGGACCTGG - Intronic
1069656327 10:70091956-70091978 TAGGCCGAGGCTGCGTGTCCTGG + Intronic
1073060367 10:100730104-100730126 CGCGCTGAGGCCGCAGGCCCAGG - Intergenic
1075686023 10:124365710-124365732 CGTGCTGAGGCCGGGGGCCCTGG - Intergenic
1076796133 10:132799321-132799343 CGGGCTCAGGCGAGGTGTCCCGG - Intergenic
1076796139 10:132799341-132799363 CGGGCTCAGGCGCGGTGTCCCGG - Intergenic
1076796151 10:132799381-132799403 CGGGCTCAGGCGAGGTGTCCCGG - Intergenic
1076796157 10:132799401-132799423 CGGGCTCAGGCGCGGTGTCCCGG - Intergenic
1076796169 10:132799441-132799463 CGGGCTCAGGCGAGGTGTCCCGG - Intergenic
1076796175 10:132799461-132799483 CGGGCTCAGGCGCGGTGTCCCGG - Intergenic
1076796187 10:132799501-132799523 CGGGCTCAGGCGAGGTGTCCCGG - Intergenic
1076796193 10:132799521-132799543 CGGGCTCAGGCGCGGTGTCCCGG - Intergenic
1076796216 10:132799601-132799623 CGGGCTCAGGCGCGGTGTCCCGG - Intergenic
1076850297 10:133089076-133089098 CGGGGACAGGCCGCGTGTCTGGG + Intronic
1076879030 10:133231012-133231034 CGGGCTGAAGCGGAGCGTCCAGG - Exonic
1076915880 10:133423048-133423070 CAGGCTGAGGCGGCGTGGGCAGG + Exonic
1076945043 10:133640777-133640799 CGGGCAGAGGCCGCGAGTTCGGG - Intergenic
1078145943 11:8721878-8721900 TGGGCTGAGGGAGCGTTTCCAGG - Intronic
1083722031 11:64607936-64607958 CGGGCGGGGGCAGCGTGTCTTGG + Exonic
1083728314 11:64639982-64640004 AGGGATGAGGCCACCTGTCCTGG - Intronic
1083842763 11:65314379-65314401 AAGGCAGAGGCCGCGTGGCCTGG - Intergenic
1083965872 11:66043430-66043452 CGTGCGGCGGCCGCGTGGCCGGG + Exonic
1084128817 11:67118585-67118607 CGGGCTGGGCCCGCGGGACCTGG - Intergenic
1085312584 11:75525313-75525335 CGGGCTGGTGCCGCGAGCCCAGG - Exonic
1091748878 12:3010458-3010480 CGGGCTCAGGCCTCCTCTCCAGG + Intronic
1095180917 12:39145453-39145475 GGCGCTGAGGACGCGTGTGCGGG + Intergenic
1104785019 12:131443786-131443808 CCCGCTGTGGCCACGTGTCCCGG + Intergenic
1105847888 13:24308626-24308648 GGGGCAGAGGCCGAGTGTACGGG - Intronic
1116987892 14:51240479-51240501 CGGGGTGAAGTCGTGTGTCCAGG - Intronic
1121218008 14:92263694-92263716 CGGACTGGGGCCACGTGTCTGGG + Intergenic
1122414427 14:101542050-101542072 CAGGCTGAGGCAGCCTGGCCAGG + Intergenic
1202918394 14_KI270723v1_random:6095-6117 CGGGCAGAGGCCGCGAGTTCGGG - Intergenic
1202926232 14_KI270724v1_random:28476-28498 CGGGCAGAGGCCGCGAGTTCGGG + Intergenic
1128075672 15:64823944-64823966 CTGGCTGCGGCCCCGGGTCCCGG - Exonic
1128987179 15:72230353-72230375 GGTGCTGAGGCCCCGTGTCCGGG - Intronic
1130955003 15:88621422-88621444 CGGGCTGAGGCCGCGTGTCCCGG + Intronic
1131265243 15:90911658-90911680 CAGGCTGAGGACAAGTGTCCTGG + Intronic
1132549871 16:549957-549979 TGGGCTGACCCCGCGTGGCCAGG + Intronic
1132613293 16:828390-828412 TGGGCCGAGGCCTCGTCTCCTGG + Intergenic
1133011170 16:2912438-2912460 GGGGCTGATGCTGCGGGTCCAGG - Intronic
1133023027 16:2975202-2975224 GGCTCTGAGGCCGGGTGTCCTGG + Intronic
1137290163 16:47047040-47047062 GGGGCTGGGTCCGCATGTCCAGG - Intergenic
1140512399 16:75517495-75517517 CGGGCAGGGGCCGCTTCTCCAGG - Intergenic
1142132223 16:88436328-88436350 CAGGCTGAGGCCGGGGGCCCAGG - Exonic
1142227766 16:88885819-88885841 CGGGCTGAGGGAGCGTGGCGAGG - Intronic
1142860069 17:2755866-2755888 CGGGCTGAGGCTGCGGGGCCCGG + Intergenic
1142893114 17:2957872-2957894 CGGGCAGAAGCCGGGTGCCCTGG + Intronic
1144306146 17:13971105-13971127 CGGGCAGTGGCAGCTTGTCCAGG + Intergenic
1144539116 17:16121910-16121932 GGGGGTGAGGCAGCTTGTCCAGG - Intronic
1145225791 17:21127093-21127115 CGAGCTAAGGCCGCGGGCCCTGG + Intronic
1150813997 17:68378421-68378443 TGGGATGAGGCAGCGTCTCCTGG + Intronic
1152439031 17:80294000-80294022 GGGGCTGAGGAGGCCTGTCCGGG + Intronic
1152910447 17:83002499-83002521 GCGGCCGAGGGCGCGTGTCCTGG - Intronic
1160575129 18:79848858-79848880 AGGGCTGAGGCCACCTGCCCGGG - Intergenic
1160921817 19:1524203-1524225 CGGGCTCGGGCCGCGTGTACAGG + Intronic
1161156677 19:2735457-2735479 TGGACTGAGGCCCCGTGTCCTGG + Intronic
1162386262 19:10362117-10362139 CTGGCTGAGGTTGAGTGTCCTGG + Exonic
1165410617 19:35658615-35658637 CGGGCTGAAGGCACGTTTCCCGG + Exonic
1167249263 19:48391947-48391969 CGGGCTGGGGCCTTGAGTCCTGG - Intergenic
1168584787 19:57583635-57583657 CGCGCTGTGGGCACGTGTCCCGG - Intronic
925942877 2:8837263-8837285 CGGGGCGAGTCCGCGTTTCCTGG - Intronic
927083654 2:19654080-19654102 CAGGCTGAGGCAGCGTGGCTGGG + Intergenic
928936590 2:36685354-36685376 GGGGCTGAGGCAGCGTAGCCAGG + Intergenic
935962265 2:108437428-108437450 CGTGCTGAGGAGGGGTGTCCTGG + Intergenic
948207100 2:236168157-236168179 CGGGGTGAGGCCGTGCGCCCCGG + Exonic
948208046 2:236173192-236173214 CGGGCGGAGGCCGGGGGTGCGGG + Intergenic
948588428 2:239035428-239035450 CCGGATGAGGCCGCGGTTCCAGG + Intergenic
948716153 2:239865007-239865029 CCGGGCGAGGCTGCGTGTCCAGG - Intergenic
948716724 2:239870041-239870063 CCGGGTGAGGCTGCATGTCCAGG - Intergenic
948716734 2:239870089-239870111 CCAGGTGAGGCTGCGTGTCCAGG - Intergenic
948716744 2:239870137-239870159 CCGGGTGAGGCTGCCTGTCCAGG - Intergenic
948716763 2:239870233-239870255 CCAGGTGAGGCTGCGTGTCCAGG - Intergenic
948716772 2:239870281-239870303 CCAGGTGAGGCTGCGTGTCCAGG - Intergenic
948716800 2:239870425-239870447 CGAGGTAAGGCTGCGTGTCCAGG - Intergenic
1172122734 20:32608261-32608283 GGGGCTGAGGCCGGGTCTCCAGG - Intronic
1172146656 20:32762437-32762459 CGGGCTGCGGCCGCGGAGCCGGG - Exonic
1174386344 20:50190457-50190479 CGGGCCGGGGCCGCGTCTCGGGG + Intergenic
1174393640 20:50233251-50233273 GGGGCTGAGGCCTCCTCTCCTGG + Intergenic
1179728038 21:43351092-43351114 CCAGCTGAGGCCTCCTGTCCAGG + Intergenic
1179976945 21:44873664-44873686 CGGGCGGAGACCGCTTGTGCTGG - Exonic
1181163034 22:20968784-20968806 CTGGCTGGGGCAGCGTGGCCTGG - Intronic
1184872377 22:47249242-47249264 CGGGCTGAGGCCCCATGCCTGGG + Intergenic
1185317637 22:50185891-50185913 CGGGCTGGGGCCGCGGGGCGGGG - Intergenic
953383703 3:42492845-42492867 GGGGCTGGGGCCTGGTGTCCAGG - Intronic
954223047 3:49166161-49166183 CCGGCGGAGGACGCGGGTCCGGG + Intronic
954540771 3:51391766-51391788 GGGGCCGAGCCCGCGTGTCCCGG + Exonic
958999850 3:100950890-100950912 GGGGCTGAGGCCACGTGCCCAGG + Intronic
967939839 3:194757205-194757227 CGTGCTGTGGCCCCGTGGCCTGG - Intergenic
968651079 4:1760597-1760619 CGGGCAGGGGGCGGGTGTCCAGG - Intergenic
968748078 4:2371203-2371225 CTGGCTGAGTCCATGTGTCCAGG - Intronic
968810320 4:2796846-2796868 GGGGCTGAGGCCGCGAGGCAGGG + Intronic
968909844 4:3472147-3472169 CGGGCTGTGGCCATGTGGCCCGG + Intronic
969330766 4:6472433-6472455 CGGGCGGCGGCCGCGGGTTCGGG + Intronic
979495737 4:121380660-121380682 CGGGCGGTGGCCCCGCGTCCCGG - Exonic
985064072 4:186104777-186104799 CGGGCGGCGGCCGCGCTTCCCGG + Intronic
985448426 4:190041287-190041309 CGGGCAGAGGCCGCGAGTTCGGG - Intergenic
991711718 5:69415182-69415204 CGGGGTGGGGCCACGTGACCGGG + Intronic
992474264 5:77087119-77087141 CCGGCTCCGGCCGCGTTTCCCGG - Exonic
997368837 5:133343121-133343143 AGGGCTCAGGCCACTTGTCCTGG + Intronic
1002046441 5:176543953-176543975 CCAGCTCAGGCCGCGGGTCCCGG + Intronic
1008952199 6:57172875-57172897 CGGACGGAGGCCGCGTGTGGCGG + Intronic
1019153281 6:170023226-170023248 GGGGCTGAGGCCGGGGTTCCCGG - Intergenic
1019433109 7:1008452-1008474 GGGGCTGAGGCCAGGTGCCCAGG - Intronic
1019487496 7:1296085-1296107 CGGGCTGAGGCTGAGTGAGCAGG + Intergenic
1032097291 7:128945970-128945992 AGGGCTGAGGTGGCATGTCCCGG - Exonic
1034293079 7:149947637-149947659 GGGGCTGGGGCAGCGTGTGCAGG + Intergenic
1034812994 7:154149236-154149258 GGGGCTGGGGCAGCGTGTGCAGG - Intronic
1035404428 7:158588239-158588261 CGGGTAGAGGCCGCCTGCCCAGG - Intergenic
1035556499 8:570945-570967 CGGCCAGAGGCAGGGTGTCCTGG - Intergenic
1036710693 8:11076708-11076730 CTGGCTGAGGCCCCGGATCCTGG - Intronic
1044737535 8:95294693-95294715 CAGGCTGAGGCCGTGTGACCTGG - Intergenic
1048986826 8:139739225-139739247 CAGGCTGGGGCTGGGTGTCCGGG - Intronic
1049263177 8:141650739-141650761 CTGGCTGGGGCAGCGTGGCCTGG - Intergenic
1051893620 9:21967196-21967218 CGGGATGAGGCAGCGTGGACAGG + Exonic
1053015264 9:34658327-34658349 TGGGCTGAGGCCGCGTGTGGTGG - Intronic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1061919084 9:133772310-133772332 CCTGCTGAGGCCTCCTGTCCTGG + Intronic
1062121411 9:134835884-134835906 TGGGATGTGCCCGCGTGTCCTGG + Intronic
1062427222 9:136511585-136511607 CCGACTGAGGCCGCCTCTCCTGG - Intronic
1062559963 9:137137090-137137112 GGGGTGGAGGCCGCGTCTCCAGG - Intergenic
1062571852 9:137189387-137189409 CGGGCAGGGGCAGCGTGGCCAGG + Intronic
1197966855 X:132073026-132073048 GTGGCTGAAGCCGCCTGTCCCGG + Intergenic