ID: 1130961280

View in Genome Browser
Species Human (GRCh38)
Location 15:88660061-88660083
Sequence ATGGAATAGGAGAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130961280_1130961285 -7 Left 1130961280 15:88660061-88660083 CCCTCCTCATTCTCCTATTCCAT No data
Right 1130961285 15:88660077-88660099 ATTCCATTCTCCCAATTTTAGGG No data
1130961280_1130961284 -8 Left 1130961280 15:88660061-88660083 CCCTCCTCATTCTCCTATTCCAT No data
Right 1130961284 15:88660076-88660098 TATTCCATTCTCCCAATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130961280 Original CRISPR ATGGAATAGGAGAATGAGGA GGG (reversed) Intergenic
No off target data available for this crispr