ID: 1130964987

View in Genome Browser
Species Human (GRCh38)
Location 15:88690441-88690463
Sequence GGGCCCCAGCTGCACTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130964978_1130964987 28 Left 1130964978 15:88690390-88690412 CCAATCCCGGTGAATGACCACAC No data
Right 1130964987 15:88690441-88690463 GGGCCCCAGCTGCACTGAGCAGG No data
1130964980_1130964987 22 Left 1130964980 15:88690396-88690418 CCGGTGAATGACCACACAGTGAA No data
Right 1130964987 15:88690441-88690463 GGGCCCCAGCTGCACTGAGCAGG No data
1130964979_1130964987 23 Left 1130964979 15:88690395-88690417 CCCGGTGAATGACCACACAGTGA No data
Right 1130964987 15:88690441-88690463 GGGCCCCAGCTGCACTGAGCAGG No data
1130964982_1130964987 11 Left 1130964982 15:88690407-88690429 CCACACAGTGAAAGGTGACAAGG No data
Right 1130964987 15:88690441-88690463 GGGCCCCAGCTGCACTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130964987 Original CRISPR GGGCCCCAGCTGCACTGAGC AGG Intergenic
No off target data available for this crispr