ID: 1130967903

View in Genome Browser
Species Human (GRCh38)
Location 15:88710669-88710691
Sequence CTAAATTGGCTTGGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130967891_1130967903 28 Left 1130967891 15:88710618-88710640 CCAGCACAGAAACATTAAGAGCC No data
Right 1130967903 15:88710669-88710691 CTAAATTGGCTTGGGGAGGAGGG No data
1130967894_1130967903 7 Left 1130967894 15:88710639-88710661 CCCTGGAGGACACAGCTCTATTT No data
Right 1130967903 15:88710669-88710691 CTAAATTGGCTTGGGGAGGAGGG No data
1130967895_1130967903 6 Left 1130967895 15:88710640-88710662 CCTGGAGGACACAGCTCTATTTA No data
Right 1130967903 15:88710669-88710691 CTAAATTGGCTTGGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130967903 Original CRISPR CTAAATTGGCTTGGGGAGGA GGG Intergenic
No off target data available for this crispr