ID: 1130968167

View in Genome Browser
Species Human (GRCh38)
Location 15:88712244-88712266
Sequence AGGCTGTGTCTGGATGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130968167_1130968178 18 Left 1130968167 15:88712244-88712266 CCACCCCCATCCAGACACAGCCT No data
Right 1130968178 15:88712285-88712307 GTCAACCCTCAGTCCTTGCCAGG No data
1130968167_1130968179 19 Left 1130968167 15:88712244-88712266 CCACCCCCATCCAGACACAGCCT No data
Right 1130968179 15:88712286-88712308 TCAACCCTCAGTCCTTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130968167 Original CRISPR AGGCTGTGTCTGGATGGGGG TGG (reversed) Intergenic
No off target data available for this crispr