ID: 1130968168

View in Genome Browser
Species Human (GRCh38)
Location 15:88712247-88712269
Sequence GGAAGGCTGTGTCTGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130968168_1130968178 15 Left 1130968168 15:88712247-88712269 CCCCCATCCAGACACAGCCTTCC No data
Right 1130968178 15:88712285-88712307 GTCAACCCTCAGTCCTTGCCAGG No data
1130968168_1130968179 16 Left 1130968168 15:88712247-88712269 CCCCCATCCAGACACAGCCTTCC No data
Right 1130968179 15:88712286-88712308 TCAACCCTCAGTCCTTGCCAGGG No data
1130968168_1130968183 30 Left 1130968168 15:88712247-88712269 CCCCCATCCAGACACAGCCTTCC No data
Right 1130968183 15:88712300-88712322 TTGCCAGGGCTGCTGAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130968168 Original CRISPR GGAAGGCTGTGTCTGGATGG GGG (reversed) Intergenic
No off target data available for this crispr