ID: 1130968176

View in Genome Browser
Species Human (GRCh38)
Location 15:88712268-88712290
Sequence GTTGACGAGGTCTCCTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130968176_1130968183 9 Left 1130968176 15:88712268-88712290 CCTCAGGAGGAGACCTCGTCAAC No data
Right 1130968183 15:88712300-88712322 TTGCCAGGGCTGCTGAAAGCTGG No data
1130968176_1130968185 20 Left 1130968176 15:88712268-88712290 CCTCAGGAGGAGACCTCGTCAAC No data
Right 1130968185 15:88712311-88712333 GCTGAAAGCTGGTTGCCAAATGG No data
1130968176_1130968179 -5 Left 1130968176 15:88712268-88712290 CCTCAGGAGGAGACCTCGTCAAC No data
Right 1130968179 15:88712286-88712308 TCAACCCTCAGTCCTTGCCAGGG No data
1130968176_1130968178 -6 Left 1130968176 15:88712268-88712290 CCTCAGGAGGAGACCTCGTCAAC No data
Right 1130968178 15:88712285-88712307 GTCAACCCTCAGTCCTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130968176 Original CRISPR GTTGACGAGGTCTCCTCCTG AGG (reversed) Intergenic