ID: 1130968177

View in Genome Browser
Species Human (GRCh38)
Location 15:88712281-88712303
Sequence GCAAGGACTGAGGGTTGACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130968177_1130968187 20 Left 1130968177 15:88712281-88712303 CCTCGTCAACCCTCAGTCCTTGC No data
Right 1130968187 15:88712324-88712346 TGCCAAATGGACAAACCTCAGGG No data
1130968177_1130968185 7 Left 1130968177 15:88712281-88712303 CCTCGTCAACCCTCAGTCCTTGC No data
Right 1130968185 15:88712311-88712333 GCTGAAAGCTGGTTGCCAAATGG No data
1130968177_1130968186 19 Left 1130968177 15:88712281-88712303 CCTCGTCAACCCTCAGTCCTTGC No data
Right 1130968186 15:88712323-88712345 TTGCCAAATGGACAAACCTCAGG No data
1130968177_1130968183 -4 Left 1130968177 15:88712281-88712303 CCTCGTCAACCCTCAGTCCTTGC No data
Right 1130968183 15:88712300-88712322 TTGCCAGGGCTGCTGAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130968177 Original CRISPR GCAAGGACTGAGGGTTGACG AGG (reversed) Intergenic