ID: 1130968179

View in Genome Browser
Species Human (GRCh38)
Location 15:88712286-88712308
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130968168_1130968179 16 Left 1130968168 15:88712247-88712269 CCCCCATCCAGACACAGCCTTCC No data
Right 1130968179 15:88712286-88712308 TCAACCCTCAGTCCTTGCCAGGG No data
1130968175_1130968179 -1 Left 1130968175 15:88712264-88712286 CCTTCCTCAGGAGGAGACCTCGT No data
Right 1130968179 15:88712286-88712308 TCAACCCTCAGTCCTTGCCAGGG No data
1130968173_1130968179 9 Left 1130968173 15:88712254-88712276 CCAGACACAGCCTTCCTCAGGAG No data
Right 1130968179 15:88712286-88712308 TCAACCCTCAGTCCTTGCCAGGG No data
1130968167_1130968179 19 Left 1130968167 15:88712244-88712266 CCACCCCCATCCAGACACAGCCT No data
Right 1130968179 15:88712286-88712308 TCAACCCTCAGTCCTTGCCAGGG No data
1130968169_1130968179 15 Left 1130968169 15:88712248-88712270 CCCCATCCAGACACAGCCTTCCT No data
Right 1130968179 15:88712286-88712308 TCAACCCTCAGTCCTTGCCAGGG No data
1130968166_1130968179 20 Left 1130968166 15:88712243-88712265 CCCACCCCCATCCAGACACAGCC No data
Right 1130968179 15:88712286-88712308 TCAACCCTCAGTCCTTGCCAGGG No data
1130968170_1130968179 14 Left 1130968170 15:88712249-88712271 CCCATCCAGACACAGCCTTCCTC No data
Right 1130968179 15:88712286-88712308 TCAACCCTCAGTCCTTGCCAGGG No data
1130968171_1130968179 13 Left 1130968171 15:88712250-88712272 CCATCCAGACACAGCCTTCCTCA No data
Right 1130968179 15:88712286-88712308 TCAACCCTCAGTCCTTGCCAGGG No data
1130968176_1130968179 -5 Left 1130968176 15:88712268-88712290 CCTCAGGAGGAGACCTCGTCAAC No data
Right 1130968179 15:88712286-88712308 TCAACCCTCAGTCCTTGCCAGGG No data
1130968165_1130968179 21 Left 1130968165 15:88712242-88712264 CCCCACCCCCATCCAGACACAGC No data
Right 1130968179 15:88712286-88712308 TCAACCCTCAGTCCTTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130968179 Original CRISPR TCAACCCTCAGTCCTTGCCA GGG Intergenic