ID: 1130968180

View in Genome Browser
Species Human (GRCh38)
Location 15:88712290-88712312
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130968180_1130968186 10 Left 1130968180 15:88712290-88712312 CCCTCAGTCCTTGCCAGGGCTGC No data
Right 1130968186 15:88712323-88712345 TTGCCAAATGGACAAACCTCAGG No data
1130968180_1130968191 26 Left 1130968180 15:88712290-88712312 CCCTCAGTCCTTGCCAGGGCTGC No data
Right 1130968191 15:88712339-88712361 CCTCAGGGACCATGAATAGTGGG No data
1130968180_1130968185 -2 Left 1130968180 15:88712290-88712312 CCCTCAGTCCTTGCCAGGGCTGC No data
Right 1130968185 15:88712311-88712333 GCTGAAAGCTGGTTGCCAAATGG No data
1130968180_1130968189 25 Left 1130968180 15:88712290-88712312 CCCTCAGTCCTTGCCAGGGCTGC No data
Right 1130968189 15:88712338-88712360 ACCTCAGGGACCATGAATAGTGG No data
1130968180_1130968187 11 Left 1130968180 15:88712290-88712312 CCCTCAGTCCTTGCCAGGGCTGC No data
Right 1130968187 15:88712324-88712346 TGCCAAATGGACAAACCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130968180 Original CRISPR GCAGCCCTGGCAAGGACTGA GGG (reversed) Intergenic