ID: 1130968182

View in Genome Browser
Species Human (GRCh38)
Location 15:88712298-88712320
Sequence AGCTTTCAGCAGCCCTGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130968182_1130968186 2 Left 1130968182 15:88712298-88712320 CCTTGCCAGGGCTGCTGAAAGCT No data
Right 1130968186 15:88712323-88712345 TTGCCAAATGGACAAACCTCAGG No data
1130968182_1130968187 3 Left 1130968182 15:88712298-88712320 CCTTGCCAGGGCTGCTGAAAGCT No data
Right 1130968187 15:88712324-88712346 TGCCAAATGGACAAACCTCAGGG No data
1130968182_1130968191 18 Left 1130968182 15:88712298-88712320 CCTTGCCAGGGCTGCTGAAAGCT No data
Right 1130968191 15:88712339-88712361 CCTCAGGGACCATGAATAGTGGG No data
1130968182_1130968189 17 Left 1130968182 15:88712298-88712320 CCTTGCCAGGGCTGCTGAAAGCT No data
Right 1130968189 15:88712338-88712360 ACCTCAGGGACCATGAATAGTGG No data
1130968182_1130968185 -10 Left 1130968182 15:88712298-88712320 CCTTGCCAGGGCTGCTGAAAGCT No data
Right 1130968185 15:88712311-88712333 GCTGAAAGCTGGTTGCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130968182 Original CRISPR AGCTTTCAGCAGCCCTGGCA AGG (reversed) Intergenic