ID: 1130968183

View in Genome Browser
Species Human (GRCh38)
Location 15:88712300-88712322
Sequence TTGCCAGGGCTGCTGAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130968170_1130968183 28 Left 1130968170 15:88712249-88712271 CCCATCCAGACACAGCCTTCCTC No data
Right 1130968183 15:88712300-88712322 TTGCCAGGGCTGCTGAAAGCTGG No data
1130968169_1130968183 29 Left 1130968169 15:88712248-88712270 CCCCATCCAGACACAGCCTTCCT No data
Right 1130968183 15:88712300-88712322 TTGCCAGGGCTGCTGAAAGCTGG No data
1130968177_1130968183 -4 Left 1130968177 15:88712281-88712303 CCTCGTCAACCCTCAGTCCTTGC No data
Right 1130968183 15:88712300-88712322 TTGCCAGGGCTGCTGAAAGCTGG No data
1130968168_1130968183 30 Left 1130968168 15:88712247-88712269 CCCCCATCCAGACACAGCCTTCC No data
Right 1130968183 15:88712300-88712322 TTGCCAGGGCTGCTGAAAGCTGG No data
1130968173_1130968183 23 Left 1130968173 15:88712254-88712276 CCAGACACAGCCTTCCTCAGGAG No data
Right 1130968183 15:88712300-88712322 TTGCCAGGGCTGCTGAAAGCTGG No data
1130968171_1130968183 27 Left 1130968171 15:88712250-88712272 CCATCCAGACACAGCCTTCCTCA No data
Right 1130968183 15:88712300-88712322 TTGCCAGGGCTGCTGAAAGCTGG No data
1130968176_1130968183 9 Left 1130968176 15:88712268-88712290 CCTCAGGAGGAGACCTCGTCAAC No data
Right 1130968183 15:88712300-88712322 TTGCCAGGGCTGCTGAAAGCTGG No data
1130968175_1130968183 13 Left 1130968175 15:88712264-88712286 CCTTCCTCAGGAGGAGACCTCGT No data
Right 1130968183 15:88712300-88712322 TTGCCAGGGCTGCTGAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130968183 Original CRISPR TTGCCAGGGCTGCTGAAAGC TGG Intergenic
No off target data available for this crispr