ID: 1130968184

View in Genome Browser
Species Human (GRCh38)
Location 15:88712303-88712325
Sequence CAACCAGCTTTCAGCAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130968184_1130968186 -3 Left 1130968184 15:88712303-88712325 CCAGGGCTGCTGAAAGCTGGTTG No data
Right 1130968186 15:88712323-88712345 TTGCCAAATGGACAAACCTCAGG No data
1130968184_1130968189 12 Left 1130968184 15:88712303-88712325 CCAGGGCTGCTGAAAGCTGGTTG No data
Right 1130968189 15:88712338-88712360 ACCTCAGGGACCATGAATAGTGG No data
1130968184_1130968191 13 Left 1130968184 15:88712303-88712325 CCAGGGCTGCTGAAAGCTGGTTG No data
Right 1130968191 15:88712339-88712361 CCTCAGGGACCATGAATAGTGGG No data
1130968184_1130968187 -2 Left 1130968184 15:88712303-88712325 CCAGGGCTGCTGAAAGCTGGTTG No data
Right 1130968187 15:88712324-88712346 TGCCAAATGGACAAACCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130968184 Original CRISPR CAACCAGCTTTCAGCAGCCC TGG (reversed) Intergenic