ID: 1130968185

View in Genome Browser
Species Human (GRCh38)
Location 15:88712311-88712333
Sequence GCTGAAAGCTGGTTGCCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130968175_1130968185 24 Left 1130968175 15:88712264-88712286 CCTTCCTCAGGAGGAGACCTCGT No data
Right 1130968185 15:88712311-88712333 GCTGAAAGCTGGTTGCCAAATGG No data
1130968180_1130968185 -2 Left 1130968180 15:88712290-88712312 CCCTCAGTCCTTGCCAGGGCTGC No data
Right 1130968185 15:88712311-88712333 GCTGAAAGCTGGTTGCCAAATGG No data
1130968181_1130968185 -3 Left 1130968181 15:88712291-88712313 CCTCAGTCCTTGCCAGGGCTGCT No data
Right 1130968185 15:88712311-88712333 GCTGAAAGCTGGTTGCCAAATGG No data
1130968182_1130968185 -10 Left 1130968182 15:88712298-88712320 CCTTGCCAGGGCTGCTGAAAGCT No data
Right 1130968185 15:88712311-88712333 GCTGAAAGCTGGTTGCCAAATGG No data
1130968177_1130968185 7 Left 1130968177 15:88712281-88712303 CCTCGTCAACCCTCAGTCCTTGC No data
Right 1130968185 15:88712311-88712333 GCTGAAAGCTGGTTGCCAAATGG No data
1130968176_1130968185 20 Left 1130968176 15:88712268-88712290 CCTCAGGAGGAGACCTCGTCAAC No data
Right 1130968185 15:88712311-88712333 GCTGAAAGCTGGTTGCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130968185 Original CRISPR GCTGAAAGCTGGTTGCCAAA TGG Intergenic