ID: 1130968186

View in Genome Browser
Species Human (GRCh38)
Location 15:88712323-88712345
Sequence TTGCCAAATGGACAAACCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130968182_1130968186 2 Left 1130968182 15:88712298-88712320 CCTTGCCAGGGCTGCTGAAAGCT No data
Right 1130968186 15:88712323-88712345 TTGCCAAATGGACAAACCTCAGG No data
1130968177_1130968186 19 Left 1130968177 15:88712281-88712303 CCTCGTCAACCCTCAGTCCTTGC No data
Right 1130968186 15:88712323-88712345 TTGCCAAATGGACAAACCTCAGG No data
1130968184_1130968186 -3 Left 1130968184 15:88712303-88712325 CCAGGGCTGCTGAAAGCTGGTTG No data
Right 1130968186 15:88712323-88712345 TTGCCAAATGGACAAACCTCAGG No data
1130968180_1130968186 10 Left 1130968180 15:88712290-88712312 CCCTCAGTCCTTGCCAGGGCTGC No data
Right 1130968186 15:88712323-88712345 TTGCCAAATGGACAAACCTCAGG No data
1130968181_1130968186 9 Left 1130968181 15:88712291-88712313 CCTCAGTCCTTGCCAGGGCTGCT No data
Right 1130968186 15:88712323-88712345 TTGCCAAATGGACAAACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130968186 Original CRISPR TTGCCAAATGGACAAACCTC AGG Intergenic