ID: 1130968187

View in Genome Browser
Species Human (GRCh38)
Location 15:88712324-88712346
Sequence TGCCAAATGGACAAACCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130968181_1130968187 10 Left 1130968181 15:88712291-88712313 CCTCAGTCCTTGCCAGGGCTGCT No data
Right 1130968187 15:88712324-88712346 TGCCAAATGGACAAACCTCAGGG No data
1130968180_1130968187 11 Left 1130968180 15:88712290-88712312 CCCTCAGTCCTTGCCAGGGCTGC No data
Right 1130968187 15:88712324-88712346 TGCCAAATGGACAAACCTCAGGG No data
1130968184_1130968187 -2 Left 1130968184 15:88712303-88712325 CCAGGGCTGCTGAAAGCTGGTTG No data
Right 1130968187 15:88712324-88712346 TGCCAAATGGACAAACCTCAGGG No data
1130968182_1130968187 3 Left 1130968182 15:88712298-88712320 CCTTGCCAGGGCTGCTGAAAGCT No data
Right 1130968187 15:88712324-88712346 TGCCAAATGGACAAACCTCAGGG No data
1130968177_1130968187 20 Left 1130968177 15:88712281-88712303 CCTCGTCAACCCTCAGTCCTTGC No data
Right 1130968187 15:88712324-88712346 TGCCAAATGGACAAACCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130968187 Original CRISPR TGCCAAATGGACAAACCTCA GGG Intergenic