ID: 1130971753

View in Genome Browser
Species Human (GRCh38)
Location 15:88739327-88739349
Sequence GCCTGCCAGGGAGGAGACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130971753_1130971760 -3 Left 1130971753 15:88739327-88739349 CCTGCGTCTCCTCCCTGGCAGGC No data
Right 1130971760 15:88739347-88739369 GGCCAGGCCTCGGTCCATCTGGG No data
1130971753_1130971759 -4 Left 1130971753 15:88739327-88739349 CCTGCGTCTCCTCCCTGGCAGGC No data
Right 1130971759 15:88739346-88739368 AGGCCAGGCCTCGGTCCATCTGG No data
1130971753_1130971764 24 Left 1130971753 15:88739327-88739349 CCTGCGTCTCCTCCCTGGCAGGC No data
Right 1130971764 15:88739374-88739396 CAGATGACCATTCACCGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130971753 Original CRISPR GCCTGCCAGGGAGGAGACGC AGG (reversed) Intergenic
No off target data available for this crispr