ID: 1130971755

View in Genome Browser
Species Human (GRCh38)
Location 15:88739336-88739358
Sequence CGAGGCCTGGCCTGCCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130971755_1130971767 24 Left 1130971755 15:88739336-88739358 CCTCCCTGGCAGGCCAGGCCTCG No data
Right 1130971767 15:88739383-88739405 ATTCACCGACCTGGCCCTCTGGG No data
1130971755_1130971766 23 Left 1130971755 15:88739336-88739358 CCTCCCTGGCAGGCCAGGCCTCG No data
Right 1130971766 15:88739382-88739404 CATTCACCGACCTGGCCCTCTGG No data
1130971755_1130971764 15 Left 1130971755 15:88739336-88739358 CCTCCCTGGCAGGCCAGGCCTCG No data
Right 1130971764 15:88739374-88739396 CAGATGACCATTCACCGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130971755 Original CRISPR CGAGGCCTGGCCTGCCAGGG AGG (reversed) Intergenic