ID: 1130971756

View in Genome Browser
Species Human (GRCh38)
Location 15:88739337-88739359
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130971746_1130971756 21 Left 1130971746 15:88739293-88739315 CCAGAGCCCCTGAATTCACAAAC No data
Right 1130971756 15:88739337-88739359 CTCCCTGGCAGGCCAGGCCTCGG No data
1130971748_1130971756 14 Left 1130971748 15:88739300-88739322 CCCTGAATTCACAAACAGAAACC No data
Right 1130971756 15:88739337-88739359 CTCCCTGGCAGGCCAGGCCTCGG No data
1130971749_1130971756 13 Left 1130971749 15:88739301-88739323 CCTGAATTCACAAACAGAAACCA No data
Right 1130971756 15:88739337-88739359 CTCCCTGGCAGGCCAGGCCTCGG No data
1130971747_1130971756 15 Left 1130971747 15:88739299-88739321 CCCCTGAATTCACAAACAGAAAC No data
Right 1130971756 15:88739337-88739359 CTCCCTGGCAGGCCAGGCCTCGG No data
1130971750_1130971756 -7 Left 1130971750 15:88739321-88739343 CCAGAACCTGCGTCTCCTCCCTG No data
Right 1130971756 15:88739337-88739359 CTCCCTGGCAGGCCAGGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130971756 Original CRISPR CTCCCTGGCAGGCCAGGCCT CGG Intergenic
No off target data available for this crispr