ID: 1130971761

View in Genome Browser
Species Human (GRCh38)
Location 15:88739349-88739371
Sequence TGCCCAGATGGACCGAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130971761_1130971767 11 Left 1130971761 15:88739349-88739371 CCAGGCCTCGGTCCATCTGGGCA No data
Right 1130971767 15:88739383-88739405 ATTCACCGACCTGGCCCTCTGGG No data
1130971761_1130971764 2 Left 1130971761 15:88739349-88739371 CCAGGCCTCGGTCCATCTGGGCA No data
Right 1130971764 15:88739374-88739396 CAGATGACCATTCACCGACCTGG No data
1130971761_1130971770 24 Left 1130971761 15:88739349-88739371 CCAGGCCTCGGTCCATCTGGGCA No data
Right 1130971770 15:88739396-88739418 GCCCTCTGGGAATACTGTCCTGG No data
1130971761_1130971766 10 Left 1130971761 15:88739349-88739371 CCAGGCCTCGGTCCATCTGGGCA No data
Right 1130971766 15:88739382-88739404 CATTCACCGACCTGGCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130971761 Original CRISPR TGCCCAGATGGACCGAGGCC TGG (reversed) Intergenic
No off target data available for this crispr