ID: 1130971763

View in Genome Browser
Species Human (GRCh38)
Location 15:88739361-88739383
Sequence TGGTCATCTGTCTGCCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130971763_1130971774 23 Left 1130971763 15:88739361-88739383 CCATCTGGGCAGACAGATGACCA No data
Right 1130971774 15:88739407-88739429 ATACTGTCCTGGCTCCAAGTGGG No data
1130971763_1130971770 12 Left 1130971763 15:88739361-88739383 CCATCTGGGCAGACAGATGACCA No data
Right 1130971770 15:88739396-88739418 GCCCTCTGGGAATACTGTCCTGG No data
1130971763_1130971766 -2 Left 1130971763 15:88739361-88739383 CCATCTGGGCAGACAGATGACCA No data
Right 1130971766 15:88739382-88739404 CATTCACCGACCTGGCCCTCTGG No data
1130971763_1130971775 24 Left 1130971763 15:88739361-88739383 CCATCTGGGCAGACAGATGACCA No data
Right 1130971775 15:88739408-88739430 TACTGTCCTGGCTCCAAGTGGGG No data
1130971763_1130971764 -10 Left 1130971763 15:88739361-88739383 CCATCTGGGCAGACAGATGACCA No data
Right 1130971764 15:88739374-88739396 CAGATGACCATTCACCGACCTGG No data
1130971763_1130971767 -1 Left 1130971763 15:88739361-88739383 CCATCTGGGCAGACAGATGACCA No data
Right 1130971767 15:88739383-88739405 ATTCACCGACCTGGCCCTCTGGG No data
1130971763_1130971773 22 Left 1130971763 15:88739361-88739383 CCATCTGGGCAGACAGATGACCA No data
Right 1130971773 15:88739406-88739428 AATACTGTCCTGGCTCCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130971763 Original CRISPR TGGTCATCTGTCTGCCCAGA TGG (reversed) Intergenic
No off target data available for this crispr