ID: 1130971765

View in Genome Browser
Species Human (GRCh38)
Location 15:88739381-88739403
Sequence CAGAGGGCCAGGTCGGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130971765_1130971778 16 Left 1130971765 15:88739381-88739403 CCATTCACCGACCTGGCCCTCTG No data
Right 1130971778 15:88739420-88739442 TCCAAGTGGGGCTGCTGAAAGGG No data
1130971765_1130971781 18 Left 1130971765 15:88739381-88739403 CCATTCACCGACCTGGCCCTCTG No data
Right 1130971781 15:88739422-88739444 CAAGTGGGGCTGCTGAAAGGGGG No data
1130971765_1130971780 17 Left 1130971765 15:88739381-88739403 CCATTCACCGACCTGGCCCTCTG No data
Right 1130971780 15:88739421-88739443 CCAAGTGGGGCTGCTGAAAGGGG No data
1130971765_1130971770 -8 Left 1130971765 15:88739381-88739403 CCATTCACCGACCTGGCCCTCTG No data
Right 1130971770 15:88739396-88739418 GCCCTCTGGGAATACTGTCCTGG No data
1130971765_1130971777 15 Left 1130971765 15:88739381-88739403 CCATTCACCGACCTGGCCCTCTG No data
Right 1130971777 15:88739419-88739441 CTCCAAGTGGGGCTGCTGAAAGG No data
1130971765_1130971773 2 Left 1130971765 15:88739381-88739403 CCATTCACCGACCTGGCCCTCTG No data
Right 1130971773 15:88739406-88739428 AATACTGTCCTGGCTCCAAGTGG No data
1130971765_1130971775 4 Left 1130971765 15:88739381-88739403 CCATTCACCGACCTGGCCCTCTG No data
Right 1130971775 15:88739408-88739430 TACTGTCCTGGCTCCAAGTGGGG No data
1130971765_1130971774 3 Left 1130971765 15:88739381-88739403 CCATTCACCGACCTGGCCCTCTG No data
Right 1130971774 15:88739407-88739429 ATACTGTCCTGGCTCCAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130971765 Original CRISPR CAGAGGGCCAGGTCGGTGAA TGG (reversed) Intergenic
No off target data available for this crispr