ID: 1130971766

View in Genome Browser
Species Human (GRCh38)
Location 15:88739382-88739404
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130971755_1130971766 23 Left 1130971755 15:88739336-88739358 CCTCCCTGGCAGGCCAGGCCTCG No data
Right 1130971766 15:88739382-88739404 CATTCACCGACCTGGCCCTCTGG No data
1130971761_1130971766 10 Left 1130971761 15:88739349-88739371 CCAGGCCTCGGTCCATCTGGGCA No data
Right 1130971766 15:88739382-88739404 CATTCACCGACCTGGCCCTCTGG No data
1130971763_1130971766 -2 Left 1130971763 15:88739361-88739383 CCATCTGGGCAGACAGATGACCA No data
Right 1130971766 15:88739382-88739404 CATTCACCGACCTGGCCCTCTGG No data
1130971758_1130971766 19 Left 1130971758 15:88739340-88739362 CCTGGCAGGCCAGGCCTCGGTCC No data
Right 1130971766 15:88739382-88739404 CATTCACCGACCTGGCCCTCTGG No data
1130971762_1130971766 5 Left 1130971762 15:88739354-88739376 CCTCGGTCCATCTGGGCAGACAG No data
Right 1130971766 15:88739382-88739404 CATTCACCGACCTGGCCCTCTGG No data
1130971757_1130971766 20 Left 1130971757 15:88739339-88739361 CCCTGGCAGGCCAGGCCTCGGTC No data
Right 1130971766 15:88739382-88739404 CATTCACCGACCTGGCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130971766 Original CRISPR CATTCACCGACCTGGCCCTC TGG Intergenic
No off target data available for this crispr