ID: 1130971770

View in Genome Browser
Species Human (GRCh38)
Location 15:88739396-88739418
Sequence GCCCTCTGGGAATACTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130971761_1130971770 24 Left 1130971761 15:88739349-88739371 CCAGGCCTCGGTCCATCTGGGCA No data
Right 1130971770 15:88739396-88739418 GCCCTCTGGGAATACTGTCCTGG No data
1130971763_1130971770 12 Left 1130971763 15:88739361-88739383 CCATCTGGGCAGACAGATGACCA No data
Right 1130971770 15:88739396-88739418 GCCCTCTGGGAATACTGTCCTGG No data
1130971762_1130971770 19 Left 1130971762 15:88739354-88739376 CCTCGGTCCATCTGGGCAGACAG No data
Right 1130971770 15:88739396-88739418 GCCCTCTGGGAATACTGTCCTGG No data
1130971765_1130971770 -8 Left 1130971765 15:88739381-88739403 CCATTCACCGACCTGGCCCTCTG No data
Right 1130971770 15:88739396-88739418 GCCCTCTGGGAATACTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130971770 Original CRISPR GCCCTCTGGGAATACTGTCC TGG Intergenic
No off target data available for this crispr