ID: 1130971775

View in Genome Browser
Species Human (GRCh38)
Location 15:88739408-88739430
Sequence TACTGTCCTGGCTCCAAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130971763_1130971775 24 Left 1130971763 15:88739361-88739383 CCATCTGGGCAGACAGATGACCA No data
Right 1130971775 15:88739408-88739430 TACTGTCCTGGCTCCAAGTGGGG No data
1130971768_1130971775 -3 Left 1130971768 15:88739388-88739410 CCGACCTGGCCCTCTGGGAATAC No data
Right 1130971775 15:88739408-88739430 TACTGTCCTGGCTCCAAGTGGGG No data
1130971769_1130971775 -7 Left 1130971769 15:88739392-88739414 CCTGGCCCTCTGGGAATACTGTC No data
Right 1130971775 15:88739408-88739430 TACTGTCCTGGCTCCAAGTGGGG No data
1130971765_1130971775 4 Left 1130971765 15:88739381-88739403 CCATTCACCGACCTGGCCCTCTG No data
Right 1130971775 15:88739408-88739430 TACTGTCCTGGCTCCAAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130971775 Original CRISPR TACTGTCCTGGCTCCAAGTG GGG Intergenic
No off target data available for this crispr