ID: 1130971777

View in Genome Browser
Species Human (GRCh38)
Location 15:88739419-88739441
Sequence CTCCAAGTGGGGCTGCTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130971772_1130971777 -2 Left 1130971772 15:88739398-88739420 CCTCTGGGAATACTGTCCTGGCT No data
Right 1130971777 15:88739419-88739441 CTCCAAGTGGGGCTGCTGAAAGG No data
1130971765_1130971777 15 Left 1130971765 15:88739381-88739403 CCATTCACCGACCTGGCCCTCTG No data
Right 1130971777 15:88739419-88739441 CTCCAAGTGGGGCTGCTGAAAGG No data
1130971769_1130971777 4 Left 1130971769 15:88739392-88739414 CCTGGCCCTCTGGGAATACTGTC No data
Right 1130971777 15:88739419-88739441 CTCCAAGTGGGGCTGCTGAAAGG No data
1130971768_1130971777 8 Left 1130971768 15:88739388-88739410 CCGACCTGGCCCTCTGGGAATAC No data
Right 1130971777 15:88739419-88739441 CTCCAAGTGGGGCTGCTGAAAGG No data
1130971771_1130971777 -1 Left 1130971771 15:88739397-88739419 CCCTCTGGGAATACTGTCCTGGC No data
Right 1130971777 15:88739419-88739441 CTCCAAGTGGGGCTGCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130971777 Original CRISPR CTCCAAGTGGGGCTGCTGAA AGG Intergenic
No off target data available for this crispr