ID: 1130975261

View in Genome Browser
Species Human (GRCh38)
Location 15:88769011-88769033
Sequence TGCACCGTGAATCTCCGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130975259_1130975261 -7 Left 1130975259 15:88768995-88769017 CCTTTAGTGTACAATATGCACCG No data
Right 1130975261 15:88769011-88769033 TGCACCGTGAATCTCCGAGAGGG No data
1130975258_1130975261 1 Left 1130975258 15:88768987-88769009 CCTCACAGCCTTTAGTGTACAAT No data
Right 1130975261 15:88769011-88769033 TGCACCGTGAATCTCCGAGAGGG No data
1130975257_1130975261 10 Left 1130975257 15:88768978-88769000 CCATGGACGCCTCACAGCCTTTA No data
Right 1130975261 15:88769011-88769033 TGCACCGTGAATCTCCGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130975261 Original CRISPR TGCACCGTGAATCTCCGAGA GGG Intergenic
No off target data available for this crispr