ID: 1130976745

View in Genome Browser
Species Human (GRCh38)
Location 15:88782362-88782384
Sequence GAGGAGTGCAGGAGTTCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130976740_1130976745 -9 Left 1130976740 15:88782348-88782370 CCTACAAAATATAGGAGGAGTGC No data
Right 1130976745 15:88782362-88782384 GAGGAGTGCAGGAGTTCAGGGGG No data
1130976736_1130976745 2 Left 1130976736 15:88782337-88782359 CCTCAAATCTCCCTACAAAATAT No data
Right 1130976745 15:88782362-88782384 GAGGAGTGCAGGAGTTCAGGGGG No data
1130976739_1130976745 -8 Left 1130976739 15:88782347-88782369 CCCTACAAAATATAGGAGGAGTG No data
Right 1130976745 15:88782362-88782384 GAGGAGTGCAGGAGTTCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130976745 Original CRISPR GAGGAGTGCAGGAGTTCAGG GGG Intergenic
No off target data available for this crispr