ID: 1130977964

View in Genome Browser
Species Human (GRCh38)
Location 15:88791834-88791856
Sequence CTCTTTGTGTGCCCTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130977964_1130977966 21 Left 1130977964 15:88791834-88791856 CCAGACACAGGGCACACAAAGAG No data
Right 1130977966 15:88791878-88791900 CATTCAACAAATATTCATTGAGG No data
1130977964_1130977967 22 Left 1130977964 15:88791834-88791856 CCAGACACAGGGCACACAAAGAG No data
Right 1130977967 15:88791879-88791901 ATTCAACAAATATTCATTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130977964 Original CRISPR CTCTTTGTGTGCCCTGTGTC TGG (reversed) Intergenic
No off target data available for this crispr