ID: 1130979447

View in Genome Browser
Species Human (GRCh38)
Location 15:88803023-88803045
Sequence TGAGGCCGCCGCGGCGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130979447_1130979454 -6 Left 1130979447 15:88803023-88803045 CCTGTCCCGCCGCGGCGGCCTCA No data
Right 1130979454 15:88803040-88803062 GCCTCAGAGTCCGGGCACTTGGG No data
1130979447_1130979453 -7 Left 1130979447 15:88803023-88803045 CCTGTCCCGCCGCGGCGGCCTCA No data
Right 1130979453 15:88803039-88803061 GGCCTCAGAGTCCGGGCACTTGG No data
1130979447_1130979456 -5 Left 1130979447 15:88803023-88803045 CCTGTCCCGCCGCGGCGGCCTCA No data
Right 1130979456 15:88803041-88803063 CCTCAGAGTCCGGGCACTTGGGG No data
1130979447_1130979458 6 Left 1130979447 15:88803023-88803045 CCTGTCCCGCCGCGGCGGCCTCA No data
Right 1130979458 15:88803052-88803074 GGGCACTTGGGGATTCTCTGAGG No data
1130979447_1130979460 21 Left 1130979447 15:88803023-88803045 CCTGTCCCGCCGCGGCGGCCTCA No data
Right 1130979460 15:88803067-88803089 CTCTGAGGGTGCAGCCCTCCTGG No data
1130979447_1130979459 7 Left 1130979447 15:88803023-88803045 CCTGTCCCGCCGCGGCGGCCTCA No data
Right 1130979459 15:88803053-88803075 GGCACTTGGGGATTCTCTGAGGG No data
1130979447_1130979461 22 Left 1130979447 15:88803023-88803045 CCTGTCCCGCCGCGGCGGCCTCA No data
Right 1130979461 15:88803068-88803090 TCTGAGGGTGCAGCCCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130979447 Original CRISPR TGAGGCCGCCGCGGCGGGAC AGG (reversed) Intergenic
No off target data available for this crispr