ID: 1130979498

View in Genome Browser
Species Human (GRCh38)
Location 15:88803196-88803218
Sequence GCGGGAGAGGAGCGCTCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130979498_1130979502 -7 Left 1130979498 15:88803196-88803218 CCCGGGGAGCGCTCCTCTCCCGC No data
Right 1130979502 15:88803212-88803234 CTCCCGCCCTGAGCGCAGGCCGG No data
1130979498_1130979507 5 Left 1130979498 15:88803196-88803218 CCCGGGGAGCGCTCCTCTCCCGC No data
Right 1130979507 15:88803224-88803246 GCGCAGGCCGGCTTCCCCATCGG 0: 1
1: 0
2: 0
3: 2
4: 84
1130979498_1130979510 18 Left 1130979498 15:88803196-88803218 CCCGGGGAGCGCTCCTCTCCCGC No data
Right 1130979510 15:88803237-88803259 TCCCCATCGGCGCGCCGGTCCGG 0: 1
1: 0
2: 0
3: 1
4: 20
1130979498_1130979515 26 Left 1130979498 15:88803196-88803218 CCCGGGGAGCGCTCCTCTCCCGC No data
Right 1130979515 15:88803245-88803267 GGCGCGCCGGTCCGGAGCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 84
1130979498_1130979509 13 Left 1130979498 15:88803196-88803218 CCCGGGGAGCGCTCCTCTCCCGC No data
Right 1130979509 15:88803232-88803254 CGGCTTCCCCATCGGCGCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 42
1130979498_1130979514 25 Left 1130979498 15:88803196-88803218 CCCGGGGAGCGCTCCTCTCCCGC No data
Right 1130979514 15:88803244-88803266 CGGCGCGCCGGTCCGGAGCCAGG 0: 1
1: 0
2: 3
3: 14
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130979498 Original CRISPR GCGGGAGAGGAGCGCTCCCC GGG (reversed) Intergenic
No off target data available for this crispr