ID: 1130979867

View in Genome Browser
Species Human (GRCh38)
Location 15:88804847-88804869
Sequence CTGTGGGGCTGGCTGCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 662
Summary {0: 1, 1: 0, 2: 20, 3: 61, 4: 580}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130979860_1130979867 9 Left 1130979860 15:88804815-88804837 CCAGCATGTTGACTGATGTGTAA 0: 1
1: 0
2: 1
3: 3
4: 99
Right 1130979867 15:88804847-88804869 CTGTGGGGCTGGCTGCCAGGAGG 0: 1
1: 0
2: 20
3: 61
4: 580
1130979859_1130979867 28 Left 1130979859 15:88804796-88804818 CCATGAAGAAGCTGGAGTTCCAG 0: 1
1: 0
2: 4
3: 29
4: 294
Right 1130979867 15:88804847-88804869 CTGTGGGGCTGGCTGCCAGGAGG 0: 1
1: 0
2: 20
3: 61
4: 580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130979867 Original CRISPR CTGTGGGGCTGGCTGCCAGG AGG Intronic
900131844 1:1090580-1090602 CTGTGGGCCTGGGAGCAAGGAGG + Intronic
900204341 1:1425720-1425742 GTGGGGGGCTGGCCTCCAGGTGG + Intergenic
900365510 1:2310534-2310556 CTGTGGGGCTTCCTCCCAGCCGG - Intergenic
900429398 1:2594709-2594731 GTGCAGGGCTGCCTGCCAGGCGG - Intronic
900595666 1:3479116-3479138 CTGTGTGCCTGGCTTCCACGGGG - Intronic
900599997 1:3498858-3498880 CTGTGGGGCCAGCTGGCTGGGGG - Intronic
900602093 1:3507121-3507143 CTGCAGGGCTGGTTGCCTGGTGG - Intronic
900743039 1:4342264-4342286 CTGAGAGGCTGGCTCCGAGGGGG - Intergenic
901081042 1:6584403-6584425 CTGTGGGGATGGCGGCCCAGTGG + Intronic
901198889 1:7455684-7455706 CTGGGGAGCTGGATGCCAGCAGG + Intronic
901923960 1:12554242-12554264 CTGGGAGGGTGGCTGTCAGGTGG + Intergenic
902062584 1:13658109-13658131 CAGACGGGGTGGCTGCCAGGCGG - Intergenic
902323460 1:15683961-15683983 CTGTGGGGGTCTCTGGCAGGCGG + Intergenic
902362946 1:15951955-15951977 GGGTGGGGCAGGCTGCCTGGTGG - Intronic
902817898 1:18926538-18926560 CTCTGAGGCTGGTGGCCAGGAGG + Intronic
902878426 1:19354866-19354888 CAGGGGAGCTGGCTGCCTGGGGG + Intronic
903967592 1:27100171-27100193 CTGTGGGCCCAGCTGCCATGCGG + Exonic
904456440 1:30651065-30651087 CTGTGGGTCTGGGTGCCAAGTGG - Intergenic
905695384 1:39969715-39969737 CTGTGGGGCCGGCTGCTCTGTGG + Exonic
905894727 1:41538112-41538134 CAGTGGGGGTGGGTGTCAGGTGG + Intronic
906956824 1:50381769-50381791 CAGACGGGCTGGCTGCCGGGCGG - Intergenic
908398174 1:63745463-63745485 CTGTGGGGCTGGGTGAGAGTGGG - Intergenic
909641124 1:77870243-77870265 CGGTCGGGGTGGCTGCCGGGCGG + Intronic
909974526 1:82029747-82029769 TTCTGGGGCTGGGTGGCAGGGGG - Intergenic
910620601 1:89249053-89249075 CTGTGGTGGTGGCAGCCATGTGG + Intergenic
910673733 1:89797854-89797876 CGGACGGGGTGGCTGCCAGGCGG + Intronic
911533583 1:99075091-99075113 CTGTGGGGCGGCCTGGCAGAGGG - Intergenic
912374598 1:109199962-109199984 CTGTGTGGCTGGGATCCAGGTGG + Exonic
912469412 1:109896175-109896197 CTGTCAGGCTGGCTGTCATGTGG - Intergenic
913021155 1:114790702-114790724 CAGACGGGGTGGCTGCCAGGCGG + Intergenic
913112890 1:115671856-115671878 CTGTGGGGAAGGCAGCCAGAGGG + Intronic
913200856 1:116494358-116494380 CTGTGCGGCTGGCTGCAAGGGGG + Intergenic
913247666 1:116884440-116884462 CAGTGGGGATAGCTGCCAGTGGG - Intergenic
914888019 1:151600426-151600448 CAGACGGGGTGGCTGCCAGGCGG - Intergenic
915242259 1:154532053-154532075 AGGTGGAGCTGCCTGCCAGGCGG + Intronic
915526525 1:156479632-156479654 CTGTAGTGCTGGCTGCTGGGGGG + Exonic
916864135 1:168837472-168837494 CTGTCGGGGCGGCTGCCCGGCGG - Intergenic
917006200 1:170419089-170419111 CAGACGGGGTGGCTGCCAGGCGG - Intergenic
917535750 1:175873129-175873151 GTGTGGTGCTGGATTCCAGGGGG - Intergenic
917968717 1:180194159-180194181 CTGTGGGGCTGGCAGCCTGAAGG + Intronic
919423893 1:197405833-197405855 CAGACGGGGTGGCTGCCAGGTGG - Intronic
920174757 1:204093598-204093620 CTGCTGGGCTGGGTGCCAAGGGG - Intronic
920399801 1:205669751-205669773 CTGTGGGGAGGGCTGCGGGGTGG - Intronic
920446292 1:206021225-206021247 CTGTGGGGCTGGGTGGCATTAGG - Intronic
920554899 1:206897573-206897595 CTTGAGGGCTGGCTGCCTGGAGG - Exonic
920794939 1:209129234-209129256 CAGACGGGGTGGCTGCCAGGCGG - Intergenic
921142688 1:212321387-212321409 CAGACGGGGTGGCTGCCAGGCGG + Intronic
921888405 1:220329307-220329329 CTTTGGGGCTGGCAGCCACCTGG + Intergenic
922272888 1:224050814-224050836 CTGTTGGACTGCCTGCCAGATGG - Intergenic
922536494 1:226384950-226384972 TTGTGGGGCTGGCTGCTCCGAGG - Intronic
922561414 1:226572461-226572483 CTGTGCGGCTGGATGCCTCGGGG + Intronic
922677448 1:227561470-227561492 CTGATGGGGTGGCTGCCAGGCGG - Intergenic
922695898 1:227730912-227730934 CTGTGTGGCAGGGTGCCAAGAGG + Intronic
922776873 1:228218772-228218794 CTATCCGGCTGGCTTCCAGGGGG + Intronic
924708854 1:246518460-246518482 CTGTGGGGCAGACTCCCAGGAGG + Intergenic
924766002 1:247032401-247032423 CGGACGGGGTGGCTGCCAGGCGG - Intergenic
1062944454 10:1449982-1450004 CGGAGGGGCTGGCTGCAAGGAGG + Intronic
1063239576 10:4153924-4153946 CTGTGCCCCTGGCTGCCAGGGGG - Intergenic
1063375806 10:5553636-5553658 CTGTGGGGCTGGGAGGGAGGAGG - Intergenic
1065412739 10:25447935-25447957 GTGTGGGACTGACTGCCAAGGGG - Intronic
1065815477 10:29479175-29479197 CTGTGAGTCTGGCTACAAGGAGG - Intronic
1065840387 10:29696788-29696810 CGGACGGGGTGGCTGCCAGGCGG - Intronic
1067510557 10:46891530-46891552 CTGTGGTGCTGGCAGCCATCTGG - Intergenic
1067651696 10:48160332-48160354 CTGTGGTGCTGGCAGCCATCTGG + Intronic
1067756838 10:49011831-49011853 CTGGGTGGCTGGCTGCCTGTGGG + Intergenic
1067792370 10:49298084-49298106 CTGTGGCCCTGGCTGTCAGCCGG + Intergenic
1069065062 10:63933762-63933784 CTGTGGTGCTGACTGTGAGGTGG + Intergenic
1069549509 10:69353132-69353154 ATGGGGGGCTGGTTGCCAGGGGG + Intronic
1069917354 10:71795816-71795838 CTGTGGGCCTGCCAGCCATGAGG - Exonic
1070966467 10:80534185-80534207 CAGACGGGGTGGCTGCCAGGCGG - Intergenic
1070983231 10:80666881-80666903 GTGTGGGACTTGCTGCCAAGAGG + Intergenic
1071329862 10:84548606-84548628 CTGTGGTTCTGTCTCCCAGGGGG - Intergenic
1071616479 10:87080774-87080796 CAGATGGGGTGGCTGCCAGGCGG - Intronic
1072445372 10:95494614-95494636 CTCTGGTGCTGGCTGCCTGAAGG - Intronic
1072602386 10:96941601-96941623 CAGACGGGGTGGCTGCCAGGCGG + Intronic
1072659657 10:97355973-97355995 TGGTGGGACAGGCTGCCAGGAGG + Intergenic
1073177895 10:101567698-101567720 CTGGGAGGCTGGAAGCCAGGAGG + Intergenic
1073350838 10:102818698-102818720 CTGGTGGGCTGGCACCCAGGGGG + Intergenic
1073465642 10:103693252-103693274 CTGGGGGCCGGGCTGGCAGGGGG - Intronic
1074387251 10:113026495-113026517 TTGTGGAGCTGGCTGACAGAAGG - Intronic
1075039351 10:119095516-119095538 CTGTGGTCCTGGCTACCTGGGGG - Intergenic
1076523428 10:131095175-131095197 CGGTGGGGTTGGCCGCCCGGTGG - Intronic
1076523442 10:131095208-131095230 CGGTGGGGTTGGCCGCCCGGTGG - Intronic
1076817216 10:132920870-132920892 GTGTGCTGCTGGCTGCCTGGGGG - Intronic
1077096103 11:799777-799799 CCCTGGGGCTGGCAGCCAGCGGG + Intronic
1077237182 11:1487368-1487390 CTGTTGGGCTGGGTGCCCTGTGG - Intronic
1077325457 11:1962058-1962080 CTCTTGGGCTGGCCCCCAGGCGG + Intronic
1077329815 11:1979334-1979356 CAGTGGGGCTGTTTGCCAGGTGG - Intronic
1077351878 11:2096874-2096896 CTGTGGGGCAGACAGCCTGGGGG - Intergenic
1077364852 11:2157511-2157533 CTGTGGGCCTGGCTCACATGGGG + Intronic
1077408534 11:2393139-2393161 CAATGGGCCTGGCTGCGAGGAGG + Intronic
1077476781 11:2794233-2794255 CGGTGGGGCTGGCAGACTGGGGG - Intronic
1077577720 11:3397380-3397402 CAGACGGGGTGGCTGCCAGGTGG - Intergenic
1077580281 11:3413150-3413172 CTGTGCACATGGCTGCCAGGAGG + Intergenic
1078176891 11:8978209-8978231 CGGTCGGGGTGGCTGCCGGGCGG - Intergenic
1078357973 11:10647031-10647053 CTGAGGGGCTGGCAGGCAGAAGG + Intronic
1079444830 11:20548543-20548565 CAGACGGGGTGGCTGCCAGGCGG - Intergenic
1080588771 11:33703588-33703610 CTGTCGGCCTGGTAGCCAGGTGG + Intronic
1080589313 11:33707741-33707763 CTGTCGGCCTGGTAGCCAGGTGG + Intronic
1080682180 11:34487221-34487243 CTCTGGGGCTGGCTCTCAGGTGG + Intronic
1082771005 11:57207344-57207366 CTAAGGGGCTGGCAGGCAGGCGG + Intergenic
1083253246 11:61481783-61481805 CTGTGGGGCAGGGCCCCAGGGGG - Exonic
1083622378 11:64055587-64055609 CTGCTGGGCTGGCTGCCTCGTGG - Intronic
1083640787 11:64144243-64144265 CAGTGGGGAAGGCTGCCTGGAGG - Intronic
1083738507 11:64695170-64695192 CAGTGGGGCTGGGGGCCAGGAGG - Intronic
1083859461 11:65412146-65412168 GTGTGGGTCTGGAGGCCAGGTGG - Exonic
1083951652 11:65959878-65959900 CTGTCAGGCTGGCTGCCGGTGGG - Exonic
1084014144 11:66368858-66368880 CTGTGGGGCTGTTGACCAGGAGG + Intronic
1084039066 11:66531122-66531144 GCGTGCGGGTGGCTGCCAGGTGG + Intronic
1084097688 11:66922699-66922721 CTGTGTTGCTGGCAGCCATGTGG - Intronic
1084237200 11:67795978-67796000 CTGTGCACATGGCTGCCAGGAGG + Intergenic
1084422979 11:69069839-69069861 CTGTGGGGAGGGCTGCAGGGAGG + Intronic
1084629632 11:70339207-70339229 CTGTGTGGCCGTCTGCCATGGGG - Exonic
1084750644 11:71202551-71202573 CTCAGGAGCTGGCTTCCAGGTGG + Intronic
1084835199 11:71796849-71796871 CTGTGCACATGGCTGCCAGGAGG - Intronic
1084924824 11:72502781-72502803 CAGACGGGGTGGCTGCCAGGCGG + Intergenic
1085119274 11:73956985-73957007 CTCTGGGGATGGCGGCGAGGCGG + Intronic
1085122642 11:73976976-73976998 CTGTGGTGCTGCCTGCTAGGAGG + Exonic
1086017264 11:82182159-82182181 CAGATGGGGTGGCTGCCAGGCGG - Intergenic
1086223306 11:84476652-84476674 CTGTTTGGCTGTCTCCCAGGAGG + Intronic
1086752541 11:90515567-90515589 GTGGGGGGCTGGCTGGCAGGTGG + Intergenic
1087161994 11:94958191-94958213 CTGTGGGGCCTGCTGCCACAGGG + Intergenic
1087214753 11:95482614-95482636 CTGATGGGGTGGCTGCCGGGCGG - Intergenic
1087701163 11:101438352-101438374 CTCTGGAGCAGCCTGCCAGGAGG - Intergenic
1088116262 11:106317422-106317444 CGGACGGGGTGGCTGCCAGGCGG + Intergenic
1088326528 11:108606484-108606506 GTGTGGGGCTGGTTACTAGGTGG - Intergenic
1089083340 11:115796115-115796137 CTGTGGTGGTGGCTGCCACAGGG - Intergenic
1089650274 11:119908359-119908381 CGGGGGGTCTGGCAGCCAGGAGG + Intergenic
1091134897 11:133179850-133179872 CTGTGAGGCTTGGTGGCAGGAGG + Intronic
1091224371 11:133948860-133948882 CTGGTGAGCTGGCTTCCAGGTGG + Intronic
1202808438 11_KI270721v1_random:17237-17259 CTCTTGGGCTGGCCCCCAGGCGG + Intergenic
1202812793 11_KI270721v1_random:34513-34535 CAGTGGGGCTGTTTGCCAGGTGG - Intergenic
1091656134 12:2348147-2348169 GCGTGGGGCTAGCTGCCAGTGGG + Intronic
1091799740 12:3317304-3317326 CCGTGGGGCTGGGTGGCTGGTGG + Intergenic
1092407866 12:8233571-8233593 CTGTGCAGATGGCTGCCAGGAGG + Intergenic
1093038517 12:14354829-14354851 CGGACGGGGTGGCTGCCAGGCGG - Intergenic
1093728662 12:22543978-22544000 CTGAGGGGCTGGGGGCGAGGTGG + Intronic
1094297905 12:28928462-28928484 CTGTGTTGGTGGCTGCCTGGTGG + Intergenic
1094716977 12:33022947-33022969 CAGATGGGGTGGCTGCCAGGCGG + Intergenic
1095739500 12:45591781-45591803 TTCAGGGGCTCGCTGCCAGGCGG - Intergenic
1096022368 12:48333303-48333325 CAGATGGGGTGGCTGCCAGGCGG + Intergenic
1096039414 12:48500669-48500691 CAGATGGGGTGGCTGCCAGGCGG + Intergenic
1096082362 12:48842101-48842123 CAGACGGGGTGGCTGCCAGGCGG - Intronic
1096542845 12:52317824-52317846 CTGAGGACCTGGCTGCCATGTGG + Intronic
1097127101 12:56783836-56783858 CGGAGGGGGTGGCTGCCGGGCGG + Intronic
1097149134 12:56963723-56963745 CGGTCGGGGTGGCTGCCAGGCGG - Intergenic
1101510619 12:105389482-105389504 CTGCAAGGGTGGCTGCCAGGTGG + Intronic
1101606119 12:106248319-106248341 AGGTGGGGCTGGCGGCCCGGCGG + Intronic
1101834585 12:108286501-108286523 GTGGGGGGCTGGCTGCAAGGAGG - Intergenic
1101855848 12:108442105-108442127 CTGGAGGACTGGCTGCCAGTGGG - Intergenic
1101884245 12:108648113-108648135 GTGTGGGGCTGGCAACAAGGGGG - Intronic
1101939100 12:109086065-109086087 AACTGGGGCTGGCTCCCAGGTGG - Exonic
1102174987 12:110867851-110867873 CGGACGGGGTGGCTGCCAGGTGG + Intronic
1102174997 12:110867891-110867913 CAGATGGGGTGGCTGCCAGGCGG + Intronic
1102268294 12:111507420-111507442 CAGACGGGGTGGCTGCCAGGCGG - Intronic
1102455855 12:113070432-113070454 CTTTGGGGGTGGCTTCCCGGAGG - Intronic
1102643784 12:114389814-114389836 CGGTGGGGCAGGCTGGGAGGTGG - Intronic
1103457059 12:121076174-121076196 CAGACGGGGTGGCTGCCAGGCGG - Intergenic
1103673260 12:122635637-122635659 CTGTGGGGCAGGGTGAGAGGAGG + Intergenic
1103944439 12:124518266-124518288 CTGTGCTGCCGGCTTCCAGGAGG + Intronic
1105980548 13:25513077-25513099 CGGACGGGGTGGCTGCCAGGCGG + Intronic
1107012429 13:35681757-35681779 GAGTGGGGCTGGCTGCCCAGAGG + Intergenic
1107498858 13:40955244-40955266 CAGACGGGGTGGCTGCCAGGCGG - Intronic
1108024403 13:46162940-46162962 CAGACGGGGTGGCTGCCAGGCGG - Intronic
1109463517 13:62695547-62695569 CTGTGGGGGTGGCAGGCATGAGG - Intergenic
1111230585 13:85340725-85340747 CTGACGGGGCGGCTGCCAGGCGG + Intergenic
1111672696 13:91348783-91348805 CTGCGGGGCGGGCTGCACGGGGG + Intergenic
1112491408 13:99867751-99867773 GTATGGCACTGGCTGCCAGGTGG + Intronic
1113583772 13:111448811-111448833 CTGTGGGGCTGGCACCCACCTGG - Intergenic
1113594800 13:111523620-111523642 TGGTGGGGCTGGCTGCAGGGAGG + Intergenic
1113618205 13:111695795-111695817 CAGTGGGGCAGGATGGCAGGAGG - Intergenic
1113623736 13:111781056-111781078 CAGTGGGGCAGGATGGCAGGAGG - Intergenic
1113878537 13:113609335-113609357 CTGTGGGACTTGCTGGGAGGTGG - Intronic
1113936976 13:113999855-113999877 CTGGGGGGGTCTCTGCCAGGGGG + Intronic
1113961752 13:114130236-114130258 CTGCAGGGCTGGCTGCCTGAGGG - Intronic
1114507883 14:23232359-23232381 CAGATGGGGTGGCTGCCAGGTGG - Intronic
1116005363 14:39285681-39285703 CGGTCGGGGTGGCTGCCGGGCGG + Intronic
1116632974 14:47357281-47357303 CTGTAGGGCTGGCTGCCCCTTGG + Intronic
1117680610 14:58199802-58199824 CTGAGGACCTGGCTGCCAAGGGG - Intronic
1118148618 14:63165713-63165735 CGGATGGGGTGGCTGCCAGGCGG - Intergenic
1118238978 14:64038001-64038023 CAGACGGGGTGGCTGCCAGGCGG + Intronic
1118428604 14:65692666-65692688 CAGATGGGGTGGCTGCCAGGCGG + Intronic
1119404453 14:74388897-74388919 CTGTGGGTGTGGCTGCCAGATGG - Intergenic
1119433226 14:74581893-74581915 CTGTGGTGGTGGCTTCCAGCAGG - Intronic
1119497975 14:75097211-75097233 CTGTGGGGGTCATTGCCAGGCGG + Exonic
1119700336 14:76750504-76750526 CGGACGGGGTGGCTGCCAGGCGG - Intergenic
1120170551 14:81244530-81244552 CGGACGGGGTGGCTGCCAGGCGG + Intergenic
1120309874 14:82814487-82814509 CAGACGGGGTGGCTGCCAGGCGG + Intergenic
1120547575 14:85829812-85829834 CGGACGGGGTGGCTGCCAGGCGG + Intergenic
1120892857 14:89505991-89506013 CGGACGGGGTGGCTGCCAGGCGG - Intronic
1121142919 14:91557622-91557644 CAGACGGGGTGGCTGCCAGGCGG + Intergenic
1121323868 14:93008506-93008528 ATCCAGGGCTGGCTGCCAGGAGG + Intronic
1122072096 14:99211433-99211455 CTCTGTGGCCGGCTGCCATGAGG - Intronic
1122564809 14:102645590-102645612 CTTTGGGGCTGGGTGGCAGGTGG - Intronic
1122692257 14:103536955-103536977 CGGTGGGGGTGGATGCCTGGAGG - Exonic
1122930846 14:104932509-104932531 CTGTGGGGCCAGGTGACAGGCGG - Intronic
1122945418 14:105006386-105006408 CTGTGGTGCTGGGCCCCAGGAGG - Intronic
1123036218 14:105473038-105473060 CTGTGGGGCTTGCTACCTGTGGG - Exonic
1123105891 14:105840880-105840902 CGGTGAGCCTGGCTCCCAGGTGG - Intergenic
1124361440 15:29039382-29039404 ATGGGGAGCTGGATGCCAGGAGG - Intronic
1125209773 15:37199890-37199912 ATGGGGGGCTGGCTTCCAGAGGG - Intergenic
1125577526 15:40765783-40765805 CTGCTTGGCTGGCTGCCAGGAGG - Exonic
1126125718 15:45293150-45293172 CAGACGGGGTGGCTGCCAGGCGG + Intergenic
1126875325 15:53035021-53035043 CAATGGCGCAGGCTGCCAGGGGG - Intergenic
1127722936 15:61720562-61720584 TTGTCGGGCTGGCTGACAAGAGG - Intergenic
1127824332 15:62690169-62690191 CGGACGGGGTGGCTGCCAGGCGG + Intronic
1127899662 15:63331540-63331562 CTCTGGGGCTGGCTGGTAAGAGG + Intronic
1128239723 15:66093750-66093772 CTGTGGGGCTGGCCACCAAGAGG - Intronic
1129054147 15:72807270-72807292 CAGAGGGGGTGGCTGCCGGGCGG + Intergenic
1129221755 15:74135319-74135341 CGGTGGGGCGGGCTGCGGGGTGG - Exonic
1129306860 15:74671659-74671681 CTCTGGTGCTGGCTGCCAAGTGG - Exonic
1129459751 15:75694612-75694634 CAGTGGGGCTGGCTGCCCTTAGG - Intronic
1129604030 15:77016075-77016097 GTGTGGGGCTGGGCTCCAGGTGG + Intronic
1129740456 15:77987242-77987264 CTGCGGGGCCGGCGGCCACGCGG - Intronic
1129832346 15:78679199-78679221 CTGGGTGACTGGGTGCCAGGAGG + Intronic
1130464593 15:84185422-84185444 AGGTGGGGCTGGCTGCCCTGAGG + Intergenic
1130499674 15:84488115-84488137 AGGTGGGGCTGGCTGCCCTGAGG - Intergenic
1130979867 15:88804847-88804869 CTGTGGGGCTGGCTGCCAGGAGG + Intronic
1132278829 15:100594756-100594778 ATGGGGTGCTGGCTGCCAGGGGG - Intronic
1132478060 16:152482-152504 CCGTGGGGCTTGGTCCCAGGAGG + Intergenic
1132574108 16:656880-656902 CCGTGGGGCTGGTGGCCAGCTGG - Intronic
1132595242 16:746170-746192 CTGTCTGGCTGGGTGGCAGGAGG + Intronic
1132663192 16:1070610-1070632 CCCTGGGGGTGGCGGCCAGGAGG - Intergenic
1132872437 16:2121903-2121925 GCTTGGGGCTGGCTGCCGGGTGG - Intronic
1132959233 16:2612886-2612908 CTGTGGGAGTGGCTCGCAGGTGG + Intergenic
1132972293 16:2694861-2694883 CTGTGGGAGTGGCTCGCAGGTGG + Intronic
1133030777 16:3010014-3010036 CTGTGTGGCTGGATTCCTGGAGG + Intergenic
1133121114 16:3608609-3608631 CTAGGGGCCTGGCTGCCAGACGG + Exonic
1133303191 16:4795462-4795484 CTGGGGGCTGGGCTGCCAGGGGG + Intronic
1133348813 16:5088401-5088423 CTGTGCACATGGCTGCCAGGAGG + Intronic
1133752114 16:8733147-8733169 CGGACGGGGTGGCTGCCAGGCGG + Intronic
1134001868 16:10789159-10789181 CTCTGAAGCTGGCTACCAGGAGG - Intronic
1134311028 16:13075343-13075365 CAGAGAGGCTGGCTGGCAGGAGG + Intronic
1135590396 16:23701000-23701022 CAGTGAGGCTAGCTGCCAGCAGG + Exonic
1136010852 16:27362763-27362785 CTCTGGGTCGGGCTGGCAGGAGG - Exonic
1136186491 16:28591567-28591589 CTGTGGGGCAGGCAGACAGGAGG - Intronic
1136188976 16:28604291-28604313 CTGTGGGGCAGGCAGACAGGAGG - Intergenic
1136189361 16:28606582-28606604 GTGTGGGGCCCGCTGCCAGGTGG + Intronic
1136270433 16:29145228-29145250 CTTTGGGGCGTGCTGGCAGGCGG + Intergenic
1137270767 16:46901038-46901060 CAATGAGGCTGGCTCCCAGGAGG - Intronic
1137493491 16:48951892-48951914 CGGACGGGGTGGCTGCCAGGCGG - Intergenic
1137721695 16:50631262-50631284 GGGTGGGCCTGGCTGCCACGTGG + Intronic
1137761005 16:50940354-50940376 GTGTGGATCTGGCTTCCAGGAGG - Intergenic
1137938636 16:52658972-52658994 CTGGGGGCATGCCTGCCAGGAGG - Intergenic
1139426217 16:66881272-66881294 CTGCGGGGTGGGCTGGCAGGGGG + Intronic
1139515709 16:67451245-67451267 CTGGGGGGCTGCCAGCCGGGTGG + Intronic
1141143481 16:81513258-81513280 GTGTGGGGCTTCCTGCCAGCAGG + Intronic
1141301074 16:82816180-82816202 CAGTGGGGTTTGCTTCCAGGAGG - Intronic
1141427383 16:83953042-83953064 CTGCTGGGCGGCCTGCCAGGGGG - Intronic
1142074019 16:88107037-88107059 CTTTGGGGCGTGCTGGCAGGCGG + Intronic
1142139564 16:88466818-88466840 CTGAGAGGCTGCCGGCCAGGGGG - Intronic
1142615911 17:1135046-1135068 CTGTGTGGGTGCCTGCCAGGCGG + Intronic
1142698417 17:1645796-1645818 CGGAGGGGCGGGCTGCCACGAGG + Intergenic
1142707901 17:1708219-1708241 CTGTGACCCTGGCTCCCAGGTGG - Exonic
1142939871 17:3371943-3371965 CGGACGGGGTGGCTGCCAGGCGG + Intergenic
1143104612 17:4522733-4522755 CTGTGGGACTGCTTTCCAGGGGG + Intronic
1143119821 17:4599709-4599731 CTCTGGTTCTGGCTGCCAAGGGG - Intronic
1143121082 17:4607305-4607327 CTGTGGGGCTGGCTGATGGCTGG + Intronic
1143204397 17:5132221-5132243 CTGTGGCTCTGACTCCCAGGAGG - Intronic
1143342780 17:6226384-6226406 CAGACGGGGTGGCTGCCAGGCGG - Intergenic
1143593133 17:7897948-7897970 CTGTGGGGCAGGAGGCCATGGGG - Intronic
1143707726 17:8711016-8711038 CTGTGGGGCTAGCTGTCAGCTGG - Intergenic
1144208439 17:12995348-12995370 GTGTGTGGCTAGCTGGCAGGTGG - Intronic
1144788071 17:17842752-17842774 CTGAGGGGCCTGCTTCCAGGAGG + Intergenic
1144872675 17:18380653-18380675 GTGTGGTGCTGGGTGTCAGGCGG - Intronic
1144875469 17:18394909-18394931 CTGTGGGGCTGACTCCCAGGAGG - Intergenic
1145015963 17:19398443-19398465 AAATTGGGCTGGCTGCCAGGTGG + Intergenic
1145022277 17:19441616-19441638 CAGACGGGGTGGCTGCCAGGCGG - Intergenic
1145156756 17:20549512-20549534 CTGTGGGGCTGACTCCCAGGAGG + Intergenic
1145798934 17:27671396-27671418 CTGTGGGGCTGACTCCCAGGAGG + Intergenic
1145937954 17:28726192-28726214 GTGTGGGGCTGGCGGCCGGCGGG - Exonic
1146160143 17:30555217-30555239 CTGTGGGGCTGACTCCCAGGAGG - Intergenic
1146844267 17:36173600-36173622 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1146856572 17:36261535-36261557 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1146864045 17:36326840-36326862 CTGTGGGGCTGACTCCCAGGAGG - Intronic
1146872482 17:36385446-36385468 CTGTGGGGCTGATTCCCAGGAGG + Intronic
1146879840 17:36436531-36436553 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1146883762 17:36457682-36457704 CTGTGGGGCTGACTCCCAGAAGG + Intergenic
1147066905 17:37927428-37927450 CTGTGGGGCTGACTCCCAGGAGG - Intronic
1147075366 17:37986070-37986092 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1147078437 17:38006989-38007011 CTGTGGGGCTGACTCCCAGGAGG - Intronic
1147086891 17:38065616-38065638 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1147094375 17:38130924-38130946 CTGTGGGGCTGACTCCCAGGAGG - Intergenic
1147102836 17:38189579-38189601 CTGTGGGGCTGACTCCCAGGAGG + Intergenic
1147480077 17:40752452-40752474 CTGAGGGGCTCGCTGCAGGGAGG - Intronic
1147677925 17:42220110-42220132 CTGTGAGGCAGGCGGGCAGGAGG - Intronic
1147688123 17:42299462-42299484 CTGTGAGGCAGGCGGGCAGGAGG + Intronic
1147743246 17:42680425-42680447 CTGCGCGTCGGGCTGCCAGGTGG + Exonic
1147809703 17:43159471-43159493 CAGACGGGGTGGCTGCCAGGCGG + Intergenic
1148122583 17:45221733-45221755 CCCTGGGGCTGGGTGCCCGGCGG + Intronic
1148183095 17:45620655-45620677 CTGAGGGCCTGGCTGCCCGGGGG + Intergenic
1148265756 17:46225036-46225058 CTGAGGGCCTGGCTGCCCGGGGG - Intronic
1148406477 17:47420783-47420805 CGGATGGGGTGGCTGCCAGGCGG - Intronic
1148671308 17:49412505-49412527 GTGTGTGGCTGGCTGACAAGAGG - Intronic
1148678184 17:49457186-49457208 CTGTGGGGCTGCTTGCTATGGGG + Intronic
1148892325 17:50817215-50817237 CTGTAGGGCTGACAGCCACGGGG + Intergenic
1149458766 17:56810630-56810652 CAGAAGGGCTGGCTCCCAGGAGG + Intronic
1149633020 17:58142585-58142607 CAGACGGGGTGGCTGCCAGGCGG - Intergenic
1149847410 17:60016046-60016068 CTGTGGGGCTGACTCCCAGGAGG + Intergenic
1150085768 17:62272663-62272685 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1150284873 17:63949007-63949029 CACTGGGGCTGGGGGCCAGGAGG - Intronic
1151346813 17:73507392-73507414 CAGTGGTCCTGGCAGCCAGGAGG + Intronic
1151481986 17:74374987-74375009 CTGGGGGGCTGTCTTTCAGGAGG + Intergenic
1151715273 17:75827929-75827951 CGGTGGGGCTGGGTCCCCGGTGG - Exonic
1152339478 17:79716286-79716308 GTGTGGGGCTGACACCCAGGAGG + Intergenic
1152672700 17:81618453-81618475 CGGACGGGGTGGCTGCCAGGCGG - Intronic
1152691937 17:81722337-81722359 CAGTGGGGCTGACTGCAGGGAGG - Intergenic
1152844874 17:82593564-82593586 CTGTGGGGCCGGGAGCCAGAAGG - Intronic
1152922840 17:83074359-83074381 CAGTGGGGCGGGCTGCCAGGAGG + Intergenic
1153829873 18:8912655-8912677 GTGTGTGCCGGGCTGCCAGGAGG - Intergenic
1153983850 18:10335747-10335769 CTGTGGTGCTGGATGGCTGGGGG + Intergenic
1156452351 18:37274103-37274125 CAGTTGGGGTGGCTGCCAGGAGG - Intronic
1157566428 18:48681744-48681766 GTGTGGGGCAGGCAGGCAGGTGG - Intronic
1158259025 18:55587855-55587877 CGGGGGGGCTGGCGGCGAGGGGG + Intronic
1160684080 19:425331-425353 CTGTGCTGCTGGCTGCAGGGCGG + Intronic
1160708202 19:539636-539658 CTCTGGGGCTGGCTGCTACCAGG - Intronic
1160825373 19:1077834-1077856 CTGTGGGTGTGGGAGCCAGGAGG - Intronic
1161010432 19:1957183-1957205 CTGTGGGGCTGCCTGGAGGGAGG - Intronic
1161123304 19:2542009-2542031 GTCTGGGGCTGGCTGCAGGGCGG + Intronic
1161438248 19:4276874-4276896 CTGTGGTCCTAGCTACCAGGAGG + Intergenic
1161519017 19:4713340-4713362 CTGTGGGCCTGGCTCCCGTGAGG - Intronic
1161553028 19:4924700-4924722 CTGTGGGGGAGGCTGACAGTGGG - Intronic
1161673010 19:5624562-5624584 CTGGGGGGTGGGCGGCCAGGCGG - Intronic
1162255117 19:9483419-9483441 CAGATGGGGTGGCTGCCAGGCGG - Intronic
1162449172 19:10744221-10744243 CTGTGGGGCAGGGAGCCTGGGGG + Intronic
1162683290 19:12362603-12362625 CGGAGGGGGCGGCTGCCAGGCGG - Intronic
1163112712 19:15170964-15170986 CAGTGGGGTTGGATGCCAGGTGG - Intronic
1163677677 19:18663433-18663455 TTTTGGGGCTGGCTGGCAGTGGG + Intronic
1163871028 19:19821484-19821506 TTGTGGAGCTGACTGCCGGGAGG + Intronic
1163957945 19:20661341-20661363 CTGTGGAGCTGACTGCGGGGAGG + Intronic
1164005221 19:21142268-21142290 CTGTGGAGCTGACTGCGGGGAGG - Intronic
1164256640 19:23533573-23533595 CAGATGGGGTGGCTGCCAGGCGG + Intronic
1164301151 19:23964160-23964182 CAGATGGGGTGGCTGCCAGGCGG - Intergenic
1164387275 19:27783677-27783699 CTGAGGGACTGGCTGTCAGGGGG + Intergenic
1164854708 19:31511986-31512008 CTTTGGGCCTGGGTGCCTGGTGG - Intergenic
1164997413 19:32732429-32732451 CTCTGGGGCTGGGAACCAGGGGG + Intronic
1165090996 19:33388375-33388397 CTGTGGGGCTGGCTGAGGGTTGG + Intronic
1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG + Intergenic
1165295396 19:34922132-34922154 CGGACGGGGTGGCTGCCAGGCGG + Intergenic
1165364998 19:35359892-35359914 CTGTGGAACTGGTGGCCAGGTGG + Exonic
1165366817 19:35372361-35372383 CTGTGGAACTGGTGGCCAGGTGG + Exonic
1165831031 19:38730385-38730407 CTGATGGCCTGGCTGCCTGGTGG + Exonic
1166120341 19:40682696-40682718 CTGTGGGGGTGGACGCCAGGGGG - Intronic
1166779532 19:45333885-45333907 ATGTGGGGTTGGCTGACAGTTGG + Intronic
1167599109 19:50443688-50443710 CTGTGGGGCAGGGGGACAGGAGG - Intronic
1167736663 19:51298579-51298601 CTGTAGGGCAGGCAGGCAGGAGG + Intergenic
927833364 2:26371216-26371238 CAGACGGGGTGGCTGCCAGGCGG + Intronic
927946236 2:27136979-27137001 CTGAAGGGCTGGCTGGCCGGAGG - Exonic
928003220 2:27540548-27540570 CGGTCGGGGTGGCTGCCGGGCGG + Intronic
928386289 2:30871402-30871424 CTGTGGGGAGGGGCGCCAGGGGG - Intergenic
929765090 2:44837620-44837642 CTGAGGGGCTGTCTGGGAGGTGG + Intergenic
929889229 2:45905671-45905693 CTGGGAGGGTGGATGCCAGGTGG + Intronic
929943883 2:46355979-46356001 CAGTGGTGCCTGCTGCCAGGCGG + Intronic
929968371 2:46552380-46552402 CTGTTTGGGGGGCTGCCAGGCGG + Intronic
932576792 2:72966784-72966806 CTGTGGGCCTGGCAGCAAGAAGG - Intronic
932784198 2:74585502-74585524 CTGCCTGGCTGGCTGCCAGGAGG - Intronic
933734949 2:85487780-85487802 CAGAGGGTGTGGCTGCCAGGCGG - Intergenic
933734956 2:85487820-85487842 CAGACGGGGTGGCTGCCAGGCGG - Intergenic
933942146 2:87253767-87253789 GTGTGGGGATGGGTACCAGGAGG + Intergenic
934309653 2:91851869-91851891 CAGATGGGGTGGCTGCCAGGCGG - Intergenic
934549086 2:95243646-95243668 CAGACGGGGTGGCTGCCAGGCGG - Intronic
934948016 2:98555910-98555932 CTGCAGGGAGGGCTGCCAGGTGG + Intronic
934951125 2:98576422-98576444 CTGTGGGGCTGGTGGTCAGGAGG + Intronic
934953005 2:98592111-98592133 GTGAGGGCCTGCCTGCCAGGAGG - Intronic
935815597 2:106843501-106843523 CCGTGGGCCTGGCTCCCCGGGGG + Exonic
936338079 2:111607802-111607824 GTGTGGGGATGGGTACCAGGAGG - Intergenic
936520637 2:113210125-113210147 CCCTGGGGCTGGCTGCTGGGAGG + Intergenic
937910771 2:127074473-127074495 CAGTGCTGCGGGCTGCCAGGTGG - Intronic
938379688 2:130829548-130829570 GTGTGGGGCTGGGGGCCCGGTGG - Intergenic
938502075 2:131835601-131835623 AGGTGGGGCTGGCTTCCTGGGGG - Intergenic
940652419 2:156451805-156451827 CAGACGGGGTGGCTGCCAGGCGG + Intronic
941025133 2:160449130-160449152 CAGTGGGGGCGGCTGCCGGGCGG - Intronic
942379774 2:175376751-175376773 CTGTGGGCCTGTCTGACATGGGG - Intergenic
943646754 2:190414114-190414136 CTGGGGGGTTGGGTGGCAGGGGG + Intronic
944263122 2:197696530-197696552 CGGAGGGGGTGGCTGCCGGGCGG + Intronic
944751594 2:202715361-202715383 CAGACGGGGTGGCTGCCAGGCGG + Intronic
944797953 2:203207215-203207237 CAGATGGGGTGGCTGCCAGGCGG - Intronic
945030609 2:205660063-205660085 CTGTGGGGCTGGGCAGCAGGTGG + Intergenic
945425106 2:209691383-209691405 CAGAAGGGCTGGCTGCCATGGGG - Intronic
946021627 2:216644219-216644241 ATGTGGGGCTGGCAGCCAGAAGG - Intronic
946162099 2:217841582-217841604 CTGTGGTGCTGGCCAGCAGGAGG - Intronic
946193840 2:218021849-218021871 CTGGGTGGCTGGCTGCCTGCTGG - Intergenic
946902286 2:224384145-224384167 CTGTGGGACTGGGTGACAGAGGG - Intronic
947807389 2:232977930-232977952 TTGTGGGCCTGGGTGCCTGGCGG + Intronic
948423820 2:237875923-237875945 CTGTGGGGCTGGGCACCAGATGG - Intronic
948461721 2:238132895-238132917 CAGGGGGCCTGGATGCCAGGAGG - Exonic
948464164 2:238144332-238144354 GTATGTGCCTGGCTGCCAGGAGG + Intronic
948639624 2:239367075-239367097 CTGTGTGGCTGGGGGCCTGGGGG - Intronic
948651659 2:239449617-239449639 CAGACGGGGTGGCTGCCAGGCGG + Intergenic
948671854 2:239574054-239574076 CTGGGATGCTGGCTTCCAGGAGG + Intergenic
949035385 2:241813716-241813738 CTGTGGGGCCAGCTGCCTGCAGG + Intronic
1169264769 20:4161143-4161165 CTGAGGGGGTGGCTTCCCGGTGG - Intronic
1169441793 20:5639357-5639379 CTGATGGGGCGGCTGCCAGGCGG + Intergenic
1171861243 20:30405014-30405036 CAGATGGGGTGGCTGCCAGGCGG - Intergenic
1172122054 20:32604232-32604254 CTGAGGAGCTGGCTGTCGGGAGG - Intronic
1172190976 20:33061727-33061749 ATGTGGGTGCGGCTGCCAGGTGG - Intronic
1172692919 20:36803042-36803064 CTGTAGGGCTGCCTTCCAGTCGG + Exonic
1173120648 20:40286328-40286350 CTGTGTGAAAGGCTGCCAGGAGG - Intergenic
1173126936 20:40345830-40345852 CTGTGGTGCTGGTGGCCATGAGG + Intergenic
1174054486 20:47788509-47788531 CTGTGGGCCTGGCGGACACGTGG + Intergenic
1175092150 20:56513314-56513336 GTGTGGGGCTGCCTTCCAGGAGG + Exonic
1175263464 20:57688989-57689011 GTCTGGGGCGGGCTGCCAGCGGG - Intronic
1175795044 20:61765977-61765999 CTCTGGGATTGGCTCCCAGGAGG + Intronic
1175981788 20:62742395-62742417 CTGTGGGACTTGCTGCCCAGTGG - Intronic
1176231910 20:64037147-64037169 CTGTGGCACAGGCTGCCCGGAGG + Intronic
1176285189 21:5015700-5015722 CTGTGGGGCTGGGTGAGCGGGGG + Intergenic
1176369248 21:6052574-6052596 CTGTGCTGCTGGCTGCCTTGGGG + Intergenic
1178034400 21:28564046-28564068 CAGACGGGGTGGCTGCCAGGCGG - Intergenic
1179270974 21:39850766-39850788 CTGTGGAGGTGGCTGGCTGGTGG + Intergenic
1179462805 21:41549046-41549068 CCATGGGGCTGGGTGCCAGCTGG - Intergenic
1179657703 21:42855383-42855405 TTGTGGGTCTGCCAGCCAGGTGG - Intronic
1179754271 21:43485967-43485989 CTGTGCTGCTGGCTGCCTTGGGG - Intergenic
1179871992 21:44247775-44247797 CTGTGGGGCTGGGTGAGCGGGGG - Intronic
1180160172 21:45995672-45995694 CTGTGGGGCAGGCTGCACAGGGG + Intronic
1180762570 22:18221135-18221157 GTGTGGCCCTGGCAGCCAGGTGG + Intergenic
1180773097 22:18403473-18403495 GTGTGGCCCTGGCAGCCAGGTGG - Intergenic
1180804453 22:18653022-18653044 GTGTGGCCCTGGCAGCCAGGTGG - Intergenic
1180806298 22:18716388-18716410 GTGTGGCCCTGGCAGCCAGGTGG + Intergenic
1180832671 22:18913874-18913896 CTGTGGGGCAGGCTGCTGGGTGG - Intronic
1180959956 22:19758089-19758111 CTGGGGGGCTGGGCGCCAGTGGG - Intronic
1181067191 22:20312520-20312542 CTGTGGGGCAGGCTGCTGGGTGG + Intergenic
1181130592 22:20729309-20729331 CCGTGCAGCTGCCTGCCAGGTGG - Exonic
1181217244 22:21342169-21342191 GTGTGGCCCTGGCAGCCAGGTGG + Intergenic
1181296977 22:21847752-21847774 CAGACGGGCTGGCTGCCGGGCGG - Intronic
1182075514 22:27492882-27492904 CCTTGGGGCTGGCTGTCAAGTGG + Intergenic
1182552175 22:31106445-31106467 CTGTGGGGCTGGGCCGCAGGTGG - Intronic
1182991552 22:34772389-34772411 CTGGAGTGCTTGCTGCCAGGAGG - Intergenic
1183010545 22:34943162-34943184 CTTTGGGGGAGGCTGGCAGGTGG + Intergenic
1183276486 22:36901244-36901266 CTGAGGGGCTGGCTGTCAACAGG - Intergenic
1183280872 22:36931740-36931762 TTGTGGGTCTGCCGGCCAGGTGG + Intronic
1185095570 22:48804350-48804372 CTGAGGCGCCGGCTGACAGGGGG - Intronic
1185318575 22:50189848-50189870 TTGTGGGGCTGGGAACCAGGTGG + Intronic
1185340612 22:50289277-50289299 CGGTGGGGCTCCCTGCCATGTGG - Intronic
1185377080 22:50487581-50487603 CTGTGGGGCTGCCTGGGAGAGGG + Intronic
1203234930 22_KI270731v1_random:144455-144477 GTGTGGCCCTGGCAGCCAGGTGG - Intergenic
1203282756 22_KI270734v1_random:139179-139201 CTGTGGGGCAGGCTGCTGGGTGG - Intergenic
949562803 3:5218302-5218324 TTGTGGGGCTGGATGCCAGAAGG + Exonic
950001094 3:9656836-9656858 CTTTGGTGCTGGCTGGCTGGTGG + Intronic
950044277 3:9939983-9940005 CGGACGGGCTGGCTGCCCGGCGG + Intronic
950183456 3:10930849-10930871 CTGTGGCGCTGGCTCCCTGATGG - Intronic
950296855 3:11839585-11839607 CTGTGAGGCTGGCAGCAAGATGG - Intronic
950589545 3:13926664-13926686 GGGTGGGGATGGCTTCCAGGAGG + Intergenic
950599168 3:14016912-14016934 CTGATTGGCTGCCTGCCAGGAGG + Intronic
950606926 3:14090028-14090050 GGGTGGGGATGGCTTCCAGGAGG - Intergenic
951108509 3:18773178-18773200 CTCTCTGGCTGGCTGCAAGGTGG + Intergenic
951734571 3:25850052-25850074 TTGTGGGGTTGGCGGCGAGGAGG - Intergenic
952945483 3:38475839-38475861 CTGGTGGGCTGGCTGTCTGGTGG + Intronic
953228393 3:41042081-41042103 CTGTGTGGCAGGCTGGCATGTGG - Intergenic
953980966 3:47412858-47412880 CTGGGAGGCTGGCTGGCGGGAGG - Exonic
954299090 3:49689745-49689767 CTGTGGAGCTTGGGGCCAGGCGG + Intronic
954412045 3:50375022-50375044 CTTTGGGGCTGGTTGCCCGGTGG - Intronic
954430118 3:50466174-50466196 CATGGGGGCAGGCTGCCAGGTGG - Intronic
955864736 3:63371222-63371244 CTGTGGGGTGGGCTCACAGGGGG - Intronic
957053154 3:75425751-75425773 CTGTGCACATGGCTGCCAGGAGG + Intergenic
957397488 3:79660982-79661004 CTGAGGGGCTGTCTTCCAAGAGG - Intronic
958957470 3:100478103-100478125 CGGACGGGGTGGCTGCCAGGCGG + Intergenic
959683497 3:109122251-109122273 CTATGGGGATGGCTTCCAGATGG + Intergenic
960817557 3:121688982-121689004 CGGAGGGGGTGGCTGCCGGGCGG - Intronic
960997656 3:123350529-123350551 CTCTGGGGCTGAGGGCCAGGAGG + Intronic
961078163 3:124000978-124001000 CTCCTGGGCTGGCTCCCAGGAGG - Intergenic
961301680 3:125925797-125925819 CTGTGCACATGGCTGCCAGGAGG - Intergenic
961523247 3:127480417-127480439 GTGTAGGCCTGGCTTCCAGGGGG - Intergenic
961789112 3:129363515-129363537 CAGACGGGGTGGCTGCCAGGCGG + Intergenic
962343733 3:134605241-134605263 CTGTGGCCCTGGAAGCCAGGAGG - Intronic
963171557 3:142256507-142256529 CTGTGGGGGTTGCTGCTAGCTGG - Intergenic
965650064 3:170923753-170923775 CTGACGGGGTGGCTGCCGGGTGG - Intergenic
966125755 3:176574483-176574505 CTGTGTGCCTGGCTGTCGGGTGG - Intergenic
967169412 3:186811747-186811769 CGGACGGGGTGGCTGCCAGGTGG + Intergenic
967177474 3:186873938-186873960 CAGAGGGGGTGGCTGCCTGGCGG - Intergenic
968035739 3:195545962-195545984 TTGAGGGTTTGGCTGCCAGGAGG + Intergenic
968428328 4:537574-537596 CTGTGGGGCTGGATACCAAGTGG + Intronic
968466049 4:751888-751910 CAGTGGGGGTGGCAGCGAGGGGG - Intronic
968549109 4:1213383-1213405 ACATGGGCCTGGCTGCCAGGCGG + Intronic
968965783 4:3768396-3768418 GTCGGGGGGTGGCTGCCAGGGGG + Exonic
968995951 4:3946063-3946085 CTGTGCACATGGCTGCCAGGAGG + Intergenic
969321135 4:6413628-6413650 CTGTGGTGCAGGCTGAGAGGCGG - Intronic
969682241 4:8649781-8649803 CTGTGGGGCAGGCGGGCAGCGGG - Intergenic
969716078 4:8868822-8868844 GCGTGGGGCTGGATGCCAGGTGG - Intronic
970216093 4:13761284-13761306 CAGAGGGGGTGGCTGCCGGGCGG + Intergenic
971753636 4:30681191-30681213 CTGTGGGGCTGGGGGTTAGGGGG - Intergenic
972938434 4:44167946-44167968 CAGAGGGGGTGGCTGCCAGGCGG - Intergenic
973633314 4:52839501-52839523 CTGTGGTGTTTGCTGCCAGATGG + Intergenic
974597906 4:64037473-64037495 CAGACGGGGTGGCTGCCAGGCGG - Intergenic
975908889 4:79245736-79245758 CAGAGGGGGTGGCTGCCGGGCGG - Intronic
976149425 4:82077874-82077896 CAGATGGGGTGGCTGCCAGGAGG - Intergenic
976569674 4:86594166-86594188 AGGTGGAGCTGGATGCCAGGCGG + Intergenic
978409143 4:108409659-108409681 CGGTCGGGGTGGCTGCCGGGCGG - Intergenic
982040422 4:151391007-151391029 CGGTCGGGGTGGCTGCCGGGCGG - Intergenic
982122553 4:152156872-152156894 CTGGGTGAATGGCTGCCAGGAGG + Intergenic
982192049 4:152866656-152866678 CGGACGGGGTGGCTGCCAGGCGG + Intronic
982192059 4:152866696-152866718 CAGACGGGGTGGCTGCCAGGCGG + Intronic
982723496 4:158882261-158882283 CAGACGGGGTGGCTGCCAGGCGG - Intronic
983218142 4:165020147-165020169 CAGACGGGGTGGCTGCCAGGCGG + Intergenic
985521863 5:377556-377578 CTGTGGGGCAGCCTGCCACCAGG - Intronic
985892660 5:2727825-2727847 CGCTGGGGCGAGCTGCCAGGTGG - Intergenic
988602711 5:32654719-32654741 CTGTGCTGATGGCAGCCAGGAGG - Intergenic
989655855 5:43746052-43746074 CAGATGGGGTGGCTGCCAGGTGG + Intergenic
990042329 5:51389658-51389680 CCGCAGGGCTGGCTGCCTGGCGG - Exonic
990651135 5:57900761-57900783 CTATGTGGCTGGATGCCTGGTGG + Intergenic
990708740 5:58559610-58559632 CTGTAGGGCTGGATATCAGGAGG - Intergenic
990871011 5:60431232-60431254 CAGACGGGGTGGCTGCCAGGCGG + Intronic
991073799 5:62513751-62513773 CGGACGGGGTGGCTGCCAGGCGG + Intronic
991127381 5:63083903-63083925 CAGACGGGGTGGCTGCCAGGCGG + Intergenic
992000635 5:72432646-72432668 CAGTGGGCTTGGCAGCCAGGTGG - Intergenic
995275518 5:110273779-110273801 CTGTAGGGCTGGCTGTCTCGTGG + Intergenic
996070052 5:119122462-119122484 CAGACGGGGTGGCTGCCAGGCGG + Intronic
996434908 5:123423350-123423372 CTGCGGGCCTGGTTGCTAGGCGG - Intronic
996792549 5:127308105-127308127 CTGTGGGAGTACCTGCCAGGAGG + Intronic
997206144 5:132051361-132051383 CTGTGAGGCTGTCTGACAGATGG + Intergenic
997361453 5:133297849-133297871 TTGTGGGACAGGATGCCAGGTGG + Intronic
997525709 5:134551991-134552013 CTGTGGGGCAGACTGCCCTGAGG + Intronic
997657610 5:135566990-135567012 CTGTTGGTCTGACTGCCAGACGG - Intergenic
997704933 5:135940880-135940902 CTGAGAGCATGGCTGCCAGGAGG - Intronic
997802084 5:136873708-136873730 CTGAGGGGATGGCTCCCAGGGGG - Intergenic
998060075 5:139112601-139112623 CGGAGGGGTTGGCTGCCGGGCGG - Intronic
998432191 5:142076502-142076524 CAGATGGGGTGGCTGCCAGGCGG + Intergenic
998903276 5:146878128-146878150 CTGTGAGACTGGCTGCGGGGAGG - Exonic
999102865 5:149041378-149041400 CTCTGGGACTTGCTCCCAGGAGG + Intronic
999316631 5:150588402-150588424 CTGGGGGTGTGTCTGCCAGGGGG + Intergenic
999381757 5:151126293-151126315 GTGTCGGGTTGGCCGCCAGGGGG + Intronic
999769776 5:154766640-154766662 CAGTGGGGCAGGCTTCCAGGTGG + Intronic
1000032943 5:157419705-157419727 CAGACGGGGTGGCTGCCAGGCGG - Intronic
1001077900 5:168643592-168643614 CAGATGGGGTGGCTGCCAGGCGG + Intergenic
1001098848 5:168797298-168797320 CTCTGGGGCTGCCAGTCAGGTGG + Intronic
1001327648 5:170740968-170740990 CGGTGGGGCTGGCTGCCTCTCGG - Intergenic
1001533607 5:172482579-172482601 CAGCGTGGCTGGCTGCCAAGAGG - Intergenic
1001571152 5:172731607-172731629 TTGTGGCCCTGGCTGACAGGAGG - Intergenic
1001577544 5:172773945-172773967 TTGTGGGCCTGGCTGCCAGAGGG + Intergenic
1001786894 5:174421527-174421549 CTGTGGGAATGGCTGCCCTGTGG - Intergenic
1002031576 5:176433996-176434018 CAGACGGGGTGGCTGCCAGGCGG - Intergenic
1002333976 5:178465535-178465557 CTGTGGGCCTGTCCACCAGGAGG - Intronic
1002662246 5:180799377-180799399 ATGTGTGGGTGGCTGGCAGGTGG - Intronic
1003461737 6:6334984-6335006 CTCTTGGGGTGGCTCCCAGGAGG + Intergenic
1004620509 6:17326703-17326725 CTGAGGGCCTGGAGGCCAGGAGG + Intergenic
1005158760 6:22836570-22836592 CGGACGGGGTGGCTGCCAGGTGG - Intergenic
1006296728 6:33173159-33173181 CTGTGGGGCAGATTCCCAGGAGG + Intronic
1006300523 6:33191587-33191609 CACTGGGGCTGGCTGCCAACAGG - Intronic
1007430602 6:41774535-41774557 CTGTGAGGCTGGCTGCATTGAGG - Intronic
1007725415 6:43913081-43913103 CTGTGGGGGTGGCCTCCAGCAGG + Intergenic
1008555652 6:52670976-52670998 CTGTAGGCCAGGCAGCCAGGAGG - Intergenic
1009049065 6:58257843-58257865 CAGATGGGGTGGCTGCCAGGCGG - Intergenic
1009823835 6:68840551-68840573 CTGTGCTGGTGGCTGCCATGGGG + Intronic
1010030499 6:71266634-71266656 CAGACGGGGTGGCTGCCAGGCGG + Intergenic
1010245959 6:73660817-73660839 CGGAGGGGGTGGCTGCCGGGCGG + Intergenic
1011755946 6:90498325-90498347 TTGTGGGGCAGGCTGCTGGGAGG - Intergenic
1012428700 6:99142173-99142195 CAGAGGGGGTGGCTGCCGGGCGG - Intergenic
1013495058 6:110689823-110689845 CTGTGGGTCTAGCTGCCCAGTGG - Intronic
1014736379 6:125099761-125099783 CAGTTGTGCTGGCTGCCGGGCGG + Intergenic
1016973596 6:149786474-149786496 CAGACGGGGTGGCTGCCAGGCGG + Intronic
1018185896 6:161265025-161265047 CTGTGGGGATGGATGCTAGGAGG + Intronic
1018425448 6:163676345-163676367 CTGGGGAGGTGGCTGACAGGTGG - Intergenic
1018584309 6:165338908-165338930 CTGAGGGTCTGGCTGCCTTGTGG - Intronic
1018799414 6:167210656-167210678 CTGTGTGGCCGGCCGCCTGGGGG - Intergenic
1019140114 6:169937644-169937666 ATGTGGGGCCGGCGGGCAGGTGG - Intergenic
1019158353 6:170053429-170053451 CAGTGGGGCCGGCTGCCTGTGGG + Intergenic
1019597855 7:1866645-1866667 CTCTGGGGCTGGCCGGCAAGAGG - Intronic
1019649350 7:2148374-2148396 CTGTGGGGCTGGTGGGCAGTGGG - Intronic
1020013393 7:4818148-4818170 CTGTGGGGCCTTCTTCCAGGAGG + Intronic
1020014164 7:4821247-4821269 CTGTGGGGTGGGCTGTCAGGCGG - Intronic
1020212180 7:6165487-6165509 CAGTGAGGATGGCTCCCAGGTGG + Intronic
1020878176 7:13724773-13724795 TTGAGGCGCTCGCTGCCAGGAGG + Intergenic
1021735324 7:23636697-23636719 CAGACGGGGTGGCTGCCAGGCGG - Intronic
1021769558 7:23984863-23984885 CTCTGGGTCTAGCTGCCAGTGGG - Intergenic
1022896127 7:34751805-34751827 CTGTGGGACTCTCTGCCAGTTGG + Intronic
1023515504 7:40997394-40997416 CTGTGGTGCTGGTTGCCATGTGG - Intergenic
1023679230 7:42667277-42667299 GTGTGGGGCAGGCAGCAAGGAGG + Intergenic
1024041462 7:45559282-45559304 CTGTGAGGCTAGATGCAAGGTGG - Intergenic
1024083230 7:45873018-45873040 CTCTGGGGCTGGCTTCCAAGTGG + Intergenic
1024221800 7:47294625-47294647 CAGTGGATCTTGCTGCCAGGAGG - Intronic
1024525958 7:50349589-50349611 CTGTGGGGAGGGCTGGCAGCAGG + Intronic
1025022029 7:55487853-55487875 CTGGCTGGCTGGCTGGCAGGAGG - Intronic
1026622385 7:71961440-71961462 CTATGGGGCTGACTCCCAAGGGG - Intronic
1026968782 7:74455394-74455416 CTGTGTGTCTGGCTGCCCCGTGG + Intronic
1029115285 7:98233474-98233496 CTGTGGGCCTGGGTGTCGGGAGG - Exonic
1029339232 7:99929501-99929523 TTGTGCTGCTGGCTGCCAGTGGG - Exonic
1029347960 7:99992497-99992519 TTGTGCTGCTGGCTGCCAGTGGG + Intergenic
1029576319 7:101405887-101405909 CTGTGGGGCTGGCTCTCAGGTGG + Intronic
1030288314 7:107848309-107848331 CAGACGGGGTGGCTGCCAGGTGG - Intergenic
1032081189 7:128859302-128859324 CTGTGTGGCTGGCTGCCCTCTGG + Intergenic
1034228555 7:149501231-149501253 CTCTGGGGTTGGCTGGCTGGAGG + Intergenic
1034233981 7:149554340-149554362 CTGATGGGGTGGCTGCCGGGCGG - Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034527548 7:151675381-151675403 CTGTGGGTGGGGCTGCCGGGTGG - Intronic
1034680817 7:152925950-152925972 CTGTGGGGCTGCCCGGGAGGGGG - Intergenic
1035062599 7:156080097-156080119 GTGAGGGGCTGGCTGCCCCGAGG - Intergenic
1036848277 8:12184670-12184692 CTGTGCACATGGCTGCCAGGAGG + Intronic
1036869639 8:12426951-12426973 CTGTGCACATGGCTGCCAGGAGG + Intronic
1036946692 8:13100799-13100821 CACTGGGGCTGGCAGCCAGCAGG + Intronic
1038540365 8:28385901-28385923 CTGTCGGGCCGGCGGCCTGGGGG - Intronic
1039149762 8:34490890-34490912 CTCTGTGGCTAGCTGACAGGAGG - Intergenic
1039920138 8:41887930-41887952 CAGTGGGGCTGGCTTCTGGGTGG + Intronic
1041192315 8:55366200-55366222 CTGACTGGCTGGCTGCCCGGTGG - Intronic
1042510213 8:69603334-69603356 ATTTGGGGCTGGCTGAGAGGAGG - Intronic
1042971790 8:74416735-74416757 CTGTGGGTCTAGCTGCCCAGTGG - Intronic
1043028928 8:75106656-75106678 CTGTGGAGATGGCTGGCAGTTGG + Intergenic
1044249846 8:89993085-89993107 CTTTGGGGCTGGGTGCCAAGGGG + Intronic
1044729187 8:95216553-95216575 CCATGGAGCTGGCTGCCAAGGGG + Intergenic
1046636280 8:116678829-116678851 CGGTCGGGGTGGCTGCCGGGCGG - Intronic
1047778391 8:128092159-128092181 CAGGGGGGCTGGCTGACAGCAGG - Intergenic
1048933701 8:139338197-139338219 TTGTGTGGCTGGCATCCAGGAGG - Intergenic
1048999790 8:139817537-139817559 CTGTGGGGCAGGAGACCAGGAGG - Intronic
1049167063 8:141133084-141133106 CTGTGGTCCTGGCTGCGGGGTGG + Intronic
1049597568 8:143491770-143491792 CTGTGGGGCCGGGTGCAGGGTGG + Intronic
1049616412 8:143577558-143577580 CGGCGGGGCTGGCTGCCCAGGGG - Intronic
1049690746 8:143957826-143957848 CAGCAGGGCAGGCTGCCAGGGGG - Intronic
1049816559 8:144605822-144605844 GAGTGGGGTTGGCTGCCCGGGGG - Intergenic
1050393022 9:5167132-5167154 CTGTGTGGCTGGCTCCCAGGTGG - Intronic
1050399129 9:5231964-5231986 CTGTATCTCTGGCTGCCAGGTGG - Intronic
1050726914 9:8660567-8660589 CTGAGGGGCTGGGAGCCAGCTGG - Intronic
1051342754 9:16127094-16127116 CTGAGGTGGTGGCTGCCAAGTGG - Intergenic
1051659013 9:19408849-19408871 CGGTGGGCGTGGCTTCCAGGGGG + Intergenic
1051736281 9:20202478-20202500 CAGTGAGGCTGTTTGCCAGGTGG + Intergenic
1052707556 9:32011120-32011142 CTGTGGGACTGGCAGCCAGCTGG - Intergenic
1054359747 9:64101221-64101243 CGGATGGGGTGGCTGCCAGGCGG - Intergenic
1055506654 9:76955571-76955593 CAGACGGGGTGGCTGCCAGGCGG - Intergenic
1055515377 9:77028234-77028256 CTGAAGGGCTGGCTGCAATGGGG - Intergenic
1055785326 9:79864419-79864441 GTGTGGGGCTAGGTGTCAGGGGG - Intergenic
1056336437 9:85573860-85573882 CAGACGGGGTGGCTGCCAGGCGG - Intronic
1056624867 9:88245142-88245164 CAGACGGGGTGGCTGCCAGGCGG + Intergenic
1059104661 9:111501252-111501274 CTGTGGAGCTGGCTGGGAGCAGG + Intergenic
1060265882 9:122111232-122111254 CGGTGGGCCAGGGTGCCAGGTGG - Intergenic
1060934136 9:127506037-127506059 CTGTGGGCCAGGCGGGCAGGAGG + Exonic
1061143090 9:128780313-128780335 CAGATGGGGTGGCTGCCAGGGGG - Intergenic
1061192359 9:129089200-129089222 CTGGGGGGCCTGCTGCCTGGGGG + Exonic
1061273706 9:129557925-129557947 CTGGGGACCTGGCTGTCAGGGGG + Intergenic
1061412347 9:130428446-130428468 CTGTGGGCCTGGCTTCCGGGTGG + Exonic
1061415670 9:130445582-130445604 CGGTGGGGCTGGCGGCCTCGCGG + Intronic
1061539748 9:131271715-131271737 CTGTGGGCCAGGTTCCCAGGGGG + Intronic
1062027435 9:134347009-134347031 CTGTGGAGGTGGCAGGCAGGTGG + Intronic
1062027477 9:134347149-134347171 CTATGGGGGTGGCAGGCAGGTGG + Intronic
1062343456 9:136103955-136103977 CCATGAGGCTGGCTGGCAGGAGG - Intergenic
1062357936 9:136173865-136173887 CTGTGGGGCCGGGTCCCATGGGG - Intergenic
1062408734 9:136410676-136410698 CTGTGGTGCTGGCGGCGACGCGG + Exonic
1062629055 9:137455490-137455512 CTGCGGGCCTGGCTCCCAGCGGG - Intronic
1186461500 X:9751968-9751990 CTCTGGGGCTGGCCCCCAGCAGG - Intronic
1186798192 X:13066820-13066842 ATGTGGTGATGGCTGCCATGGGG - Intergenic
1189210208 X:39277685-39277707 CGGACGGGGTGGCTGCCAGGCGG - Intergenic
1190220394 X:48509022-48509044 CTGCGGGGGAGGCTGCCCGGAGG + Intronic
1190380581 X:49836746-49836768 CTGTGGAGCTAGCTGCCAGCGGG - Intergenic
1190878315 X:54475146-54475168 CTGCAGGGCTGCCTGCAAGGAGG - Intronic
1192352869 X:70371763-70371785 CAGACGGGGTGGCTGCCAGGTGG + Intronic
1192610263 X:72559865-72559887 CGGACGGGGTGGCTGCCAGGCGG - Intronic
1193068061 X:77279457-77279479 CAGACGGGGTGGCTGCCAGGCGG - Intergenic
1195009795 X:100723840-100723862 CGGACGGGGTGGCTGCCAGGCGG - Intronic
1195115574 X:101695074-101695096 TAGTGGGACTGGCTGCCAGCTGG + Intergenic
1195221158 X:102746218-102746240 CGGCGGGGCAGGCTGCCAGCCGG - Intronic
1195706739 X:107742918-107742940 CTGTGGGGCTGGCAGCCTGTGGG - Intronic
1195937450 X:110139313-110139335 CTGTGGGGATGGGTGCAGGGAGG + Intronic
1197225175 X:123949786-123949808 CTGTGTGGCTGGCTGGCAGAAGG + Intergenic
1197775664 X:130117331-130117353 CAGGAGGGCTGGCTGCCTGGAGG + Intergenic
1197864958 X:131007990-131008012 CTGTGGGGTTGGCTGGCACAGGG - Intergenic
1198047682 X:132918717-132918739 CTGTTTGGCTGGCTGTCAGTAGG - Intronic
1198831613 X:140757136-140757158 CTTGGTGGCTGGCTGCCAAGTGG - Intergenic
1200043720 X:153388480-153388502 CTGGGTAGATGGCTGCCAGGAGG + Intergenic
1200045857 X:153400832-153400854 CTGTGGGGCTGGGGGTCGGGAGG - Intergenic
1200051263 X:153433096-153433118 CTGTGTGGCTGGAGGCCAGTGGG + Intergenic
1200064899 X:153499648-153499670 CTGTGGGAGTGGCTGCCTGAGGG - Intronic
1200178369 X:154134498-154134520 CTATGGTGCTGGCTTCCAAGAGG - Intergenic
1200230041 X:154439307-154439329 CTGCACGGCTGGCTGCCAGGAGG + Intronic
1200934763 Y:8728673-8728695 CTGTGGGGCTCTCTCTCAGGTGG - Intergenic
1202179523 Y:22127637-22127659 CTGTGGGGCTCTTTCCCAGGTGG - Intergenic
1202211838 Y:22458757-22458779 CTGTGGGGCTCTTTCCCAGGTGG + Intergenic