ID: 1130980898

View in Genome Browser
Species Human (GRCh38)
Location 15:88811288-88811310
Sequence TTTTTCCTAAAGCAGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 1, 2: 5, 3: 42, 4: 422}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130980893_1130980898 25 Left 1130980893 15:88811240-88811262 CCTTGGAAATCACCAAGTTTTTC 0: 1
1: 0
2: 3
3: 31
4: 308
Right 1130980898 15:88811288-88811310 TTTTTCCTAAAGCAGATGGAGGG 0: 1
1: 1
2: 5
3: 42
4: 422
1130980894_1130980898 13 Left 1130980894 15:88811252-88811274 CCAAGTTTTTCAAACTGAATTTG 0: 1
1: 0
2: 9
3: 41
4: 396
Right 1130980898 15:88811288-88811310 TTTTTCCTAAAGCAGATGGAGGG 0: 1
1: 1
2: 5
3: 42
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130980898 Original CRISPR TTTTTCCTAAAGCAGATGGA GGG Intronic
901340467 1:8494285-8494307 TTTATTTTAAAGCACATGGAGGG - Intronic
901455414 1:9360318-9360340 TTGTTGCCAAAGCTGATGGACGG - Intronic
902134521 1:14293425-14293447 ATTTTCTTAAAGAAGAAGGAGGG - Intergenic
902143712 1:14378984-14379006 TCTCTCCTCAAGCAGAAGGAAGG - Intergenic
902477498 1:16696047-16696069 ATTTCCCTAAAGAAGATGGCCGG + Intergenic
904493614 1:30874916-30874938 TTGTTACTAAGGCAGCTGGAGGG - Intronic
905692236 1:39952019-39952041 TTTTTCACAAAGCAGCAGGAAGG + Intergenic
906877864 1:49557873-49557895 TTTCTTCTCAAGCAGAAGGAAGG - Intronic
907505817 1:54917473-54917495 TTTTTCCTCAATCACCTGGAAGG + Intergenic
907683102 1:56582363-56582385 TTATTCCAAAAGCAGATAAAAGG + Intronic
908471337 1:64446874-64446896 GTTTTCCTGAAACAGAAGGAAGG - Intergenic
908597196 1:65700922-65700944 TTTTTTTTAAAGCAGTTGGTTGG + Intergenic
908816033 1:68035488-68035510 TTCTTCATAAAGCAGTAGGAAGG + Intergenic
909431259 1:75590163-75590185 TCTGTCCTCAAGCAGAAGGAAGG - Intronic
910499989 1:87879316-87879338 TTTTTTTTAAAGCAGAGGGAGGG + Intergenic
910801203 1:91148650-91148672 TCTCTCCTCAAGCAGAAGGAAGG + Intergenic
910948392 1:92618008-92618030 ATCATCCTAAAGCAGCTGGATGG + Intronic
912189754 1:107324059-107324081 CATTTCTTAAAGCACATGGAAGG + Intronic
912724504 1:112046648-112046670 TTTTGGTTTAAGCAGATGGAAGG - Intergenic
913313365 1:117527315-117527337 TATTTACAAAAGCAGATGGAGGG + Exonic
915682105 1:157591209-157591231 TCTTTCCTAAAGTAGAGAGAAGG + Intronic
915816404 1:158971207-158971229 TTTGTCCTTAAGGAGATGGAAGG - Intronic
916821486 1:168403153-168403175 TCTTTCCCAGAGCAGATGGATGG + Intergenic
917312824 1:173694473-173694495 ATTTTTATAAACCAGATGGAAGG + Intergenic
918156057 1:181847918-181847940 TTTTTCCTTTATCAGATGCATGG - Intergenic
920272563 1:204777172-204777194 TTTTTGCTAATTAAGATGGAGGG + Intergenic
920978121 1:210804933-210804955 TTCTTCCTAATGCAAATGTAGGG - Intronic
921246497 1:213248202-213248224 TTTTTCCTAAAACAGAAAGAAGG + Intronic
922651834 1:227347046-227347068 TTTTTCCTATTGCAGACAGACGG + Intergenic
923542483 1:234898565-234898587 TGATTCCTAAAACAGATGGTTGG - Intergenic
923761584 1:236850384-236850406 TTTTTTCACAAGCAGATGGTAGG - Exonic
923894269 1:238251720-238251742 TTTTTTCTAAAGAGGATGAAAGG - Intergenic
923986318 1:239386718-239386740 TTTCTCCAAAAGCAGAGAGAAGG - Intronic
924270430 1:242326555-242326577 GTTTTCCTAAGCCAGAAGGAGGG - Intronic
1063126578 10:3141732-3141754 CTTTTCCTAAAGTGGATGAAGGG + Intronic
1063496727 10:6516362-6516384 TTTTATCTAAAGGAGATGGTTGG + Intronic
1064454986 10:15478887-15478909 TTTTTTTAAAAGCAGATGGTGGG + Intergenic
1065799027 10:29334156-29334178 TTTTTTCTTAAGCAGATAGCTGG - Intergenic
1065895637 10:30160983-30161005 TTTTTCCTGAAGCAGAAGAGTGG + Intergenic
1066714503 10:38272245-38272267 GTTTTCCTAAGCCAGAAGGAGGG + Intergenic
1066783570 10:38978465-38978487 GTTTTCCTAAGCCAGAAGGAGGG - Intergenic
1067048336 10:42998399-42998421 TGTTTATTAAAGGAGATGGATGG - Intergenic
1068712697 10:60151539-60151561 TCTTACCAGAAGCAGATGGATGG + Intronic
1069404206 10:68080931-68080953 TTCTTCCTAAAGCCTTTGGAGGG - Intergenic
1072559353 10:96556538-96556560 GTTTTCCTTAAGTAGAAGGAAGG - Intronic
1073585058 10:104702080-104702102 TATTTACTGAAACAGATGGAGGG + Intronic
1077662710 11:4083882-4083904 TTATTGCTAAAGTAGATGAATGG + Intronic
1078259331 11:9689966-9689988 TTTTTCCAGAAACAGAGGGAAGG + Intronic
1079384820 11:19969413-19969435 TTATCTCTAAAGCAGATGCAAGG + Intronic
1079773620 11:24496608-24496630 ATTTGCCTGAAACAGATGGAAGG - Intergenic
1082953754 11:58846930-58846952 TCATTCCTCAAGCAGAGGGAAGG - Intronic
1083505881 11:63156941-63156963 CTTCTCCTCAAGCAGAAGGAAGG + Intronic
1084120842 11:67068108-67068130 TTTTTACCAGAGCAGCTGGAAGG + Intronic
1084839645 11:71834908-71834930 TTGTTCCTAAAGCAAATAGCTGG + Intronic
1085014376 11:73163264-73163286 TTTTACCTTAAGCTGGTGGAGGG + Intergenic
1086390124 11:86355189-86355211 TTTTTCCTAGAGAACTTGGAAGG + Intergenic
1086553363 11:88079886-88079908 TTATTCCTAAATCTGATGGCAGG + Intergenic
1087380502 11:97399040-97399062 TTTCTCTTCAAGCAGAAGGAAGG + Intergenic
1087417191 11:97871971-97871993 ATTCTCCTTAAGCAGAAGGAAGG + Intergenic
1088142092 11:106629807-106629829 TGTTTCCTAAAGCAGATGCAAGG + Intergenic
1089032104 11:115342395-115342417 TGTGTCCTGAAGGAGATGGAAGG + Intronic
1089683496 11:120132536-120132558 TTTTCCCGAGAGCAGATGGGTGG + Intronic
1089762259 11:120736339-120736361 TCTGTCCTCAAGCAGAAGGAAGG + Intronic
1089937023 11:122375208-122375230 TTTCTCCTCATGCAGAAGGAAGG - Intergenic
1090141650 11:124271093-124271115 TTGTTCTTAGGGCAGATGGAAGG - Intergenic
1090576029 11:128104896-128104918 TTGTTCCTAAACAAGATAGAAGG + Intergenic
1090985165 11:131760221-131760243 TTTTTCCGGAAGCAGATGCAGGG + Intronic
1091142018 11:133243533-133243555 ATTTTCTTAAAGCAGATGCCTGG - Intronic
1091642658 12:2249300-2249322 TATTTACAAAAGCAGATGGCAGG - Intronic
1092641286 12:10513449-10513471 TTTTTTCTGAGACAGATGGATGG + Intronic
1092746517 12:11677479-11677501 TTGTTTCTTAAGCAGATGGATGG + Intronic
1092896224 12:13013186-13013208 ATTGTCCTAAATAAGATGGAAGG - Intergenic
1092919663 12:13219981-13220003 CTTTTCCTAAAGCATTTGCAGGG - Intergenic
1093124617 12:15313545-15313567 TCTCTCCTCAAGCAGAAGGAAGG + Intronic
1093337864 12:17931624-17931646 TATTTCCTAAATCAGATGTGAGG - Intergenic
1093420082 12:18964996-18965018 TCTCTCCTCAAGCAGAAGGAAGG + Intergenic
1093694448 12:22144106-22144128 CTTCTCCTCAAGCAGAAGGAAGG - Intronic
1094087927 12:26614186-26614208 TTTTTCCCTTAGAAGATGGAGGG - Intronic
1095771932 12:45969645-45969667 TTTTCCCTAAAGCAAATGCAAGG + Intronic
1095830287 12:46578483-46578505 TTTTACCAAAAGGAGAAGGAGGG - Intergenic
1096014126 12:48252154-48252176 ATTTTAGTAAAGAAGATGGAAGG - Intergenic
1097522494 12:60686921-60686943 ATTTTCCTAAAACACATGGCTGG + Intergenic
1097892341 12:64790396-64790418 TTTTCCTGAAAGCAGAAGGAAGG + Intronic
1097927323 12:65143551-65143573 TTTTTCCTAACTCAGTAGGATGG + Intergenic
1098060270 12:66554150-66554172 TCTCTCCTCAAGAAGATGGAAGG - Intronic
1098416611 12:70242745-70242767 TTTTTCCCCAACCTGATGGAAGG - Intergenic
1098606144 12:72392666-72392688 TGTTTACTAAAACAGATGGTTGG + Intronic
1099562283 12:84193180-84193202 TCTCTCCTCAAGCAGAAGGAAGG + Intergenic
1099638615 12:85252543-85252565 TTTCTCTTAAAGAAGATGGCTGG - Intronic
1099853041 12:88128048-88128070 TATTTACAAAAGCAGATGGGAGG - Intronic
1099997609 12:89796079-89796101 CTTTTCCAGAAGCAGATGAATGG - Intergenic
1100074099 12:90757245-90757267 TTTTTCCTAAAGCTGGGTGATGG - Intergenic
1100329102 12:93569176-93569198 TTATTCCTAAAACTGACGGAGGG - Intergenic
1100459805 12:94788135-94788157 TTTTTCCTTTTGCAGATAGATGG + Intergenic
1103058339 12:117839005-117839027 TATTTACAAAAGCAGGTGGAGGG + Intronic
1105747636 13:23392727-23392749 TTTCTCCTAAAGGAGGCGGAAGG + Intronic
1107106765 13:36651781-36651803 TATTTACAAAAGCAGATGGTGGG - Intergenic
1109550150 13:63884791-63884813 TTTTTCCTAGAACTGGTGGAGGG + Intergenic
1110875002 13:80498175-80498197 CTTTTCCAGAAGCAGCTGGATGG + Intergenic
1110916798 13:81030932-81030954 CCTTTCCTCAAGCAGAAGGAAGG + Intergenic
1111064054 13:83066960-83066982 CTTGTCTTAAAGCAGATTGAGGG - Intergenic
1111694591 13:91607355-91607377 TTTTTCCTCAAGCAAACTGAAGG + Intronic
1112964065 13:105165330-105165352 TTTTTACTAAAGAAGATATACGG + Intergenic
1113253888 13:108486049-108486071 TCTCTCCTCAAGCAGAAGGAAGG - Intergenic
1114248013 14:20933066-20933088 CCTTTCCTCAAGCAGAAGGAAGG - Intergenic
1114250847 14:20959165-20959187 CCTTTCCTCAAGCAGAAGGAAGG - Intergenic
1114268358 14:21086399-21086421 TTTTTAATAAAGCAAATGGCTGG + Intronic
1115625662 14:35189440-35189462 TTTTTTTTAAAGAAGAGGGAAGG + Intronic
1116458501 14:45145232-45145254 TTTTTCCTCAAGCAGAAGGAAGG + Intronic
1116577293 14:46590275-46590297 TTTTTAATAAATCAGAAGGATGG - Intergenic
1116725208 14:48554321-48554343 CTTCTCCTCAAGCAGATGGAAGG + Intergenic
1117004330 14:51403167-51403189 TTTTTCTTAAACCAGGTAGATGG - Intergenic
1117110315 14:52446664-52446686 CTTCTCCTTAAGCAGAAGGAAGG - Intronic
1117795482 14:59388970-59388992 CTTCTCCTCAAGCAGAGGGAAGG + Intergenic
1117843075 14:59881115-59881137 TTTCTCCTCAAGCAGAGGTAAGG + Intergenic
1118096868 14:62546778-62546800 TTTCCCCTCAAGCAGAGGGAAGG - Intergenic
1118359295 14:65042645-65042667 CTTCTCCCAAAGCAAATGGAAGG - Intronic
1120395301 14:83960250-83960272 TTGTTTCTAAAGAAAATGGAAGG - Intergenic
1121149623 14:91620189-91620211 GTTTTCCTAAAGCAGCAGCATGG - Intronic
1121356521 14:93220237-93220259 TTTTCCCTAAAGAAAATGTATGG + Exonic
1123671849 15:22666539-22666561 TTTAGCCTTAAGCAGAAGGATGG + Intergenic
1124323893 15:28739751-28739773 TTTAGCCTTAAGCAGAAGGATGG + Intergenic
1124527777 15:30473001-30473023 TTTATCTTTAAGCAGAAGGATGG + Intergenic
1124582471 15:30971531-30971553 TTGTTCCTTAATCAGATGAATGG + Intronic
1124770881 15:32534701-32534723 TTTATCTTTAAGCAGAAGGATGG - Intergenic
1125374172 15:39011421-39011443 TTGTTCTTAGGGCAGATGGAAGG - Intergenic
1125811630 15:42547219-42547241 TTTTTCCTACAGCATATGTGTGG - Intronic
1125828827 15:42697152-42697174 CTTTTTGTAAAGCAGATGAATGG + Intronic
1127008312 15:54594972-54594994 TTGTTCTTAGGGCAGATGGAAGG + Intronic
1130317899 15:82811911-82811933 TTTATCCTTAAGCAGAAGGATGG + Intronic
1130660635 15:85829178-85829200 ATTTGCCTACAGCACATGGATGG - Intergenic
1130980898 15:88811288-88811310 TTTTTCCTAAAGCAGATGGAGGG + Intronic
1131902746 15:97105775-97105797 TTTTGCCTAATGAATATGGAGGG + Intergenic
1131911352 15:97207991-97208013 TTTGTCCTTAAGAAAATGGAAGG + Intergenic
1137807521 16:51321398-51321420 TTTTCCCTGAAGCAGAAGGCAGG - Intergenic
1140278636 16:73533738-73533760 TTTTTTCTTGAGCAAATGGAGGG - Intergenic
1140383584 16:74513115-74513137 TTTATCTTAAAGGAAATGGAAGG + Intronic
1140640563 16:76967150-76967172 TTTTGCCAAAAGCAGATGCTAGG + Intergenic
1141373631 16:83509518-83509540 TATTTACAAAAGCAGATGGTGGG + Intronic
1144192096 17:12855970-12855992 TTTTTCTTAAAGCAGATTGAGGG - Intronic
1145069138 17:19788307-19788329 CTTGTCCTCAAGCAGAAGGAAGG - Intronic
1146826035 17:36023939-36023961 TTTTGCCTAATAAAGATGGAGGG - Intergenic
1148330871 17:46813255-46813277 ATTTTCCTTAACCACATGGAGGG - Intronic
1149274305 17:55016633-55016655 TTTTTCCTCAATCACCTGGAAGG + Intronic
1149468050 17:56894883-56894905 TTTTTCGTGAAGCAGAAGGTGGG + Intronic
1149900142 17:60468743-60468765 TTTTTCCTTAGGCAGAAGGTTGG - Intronic
1151590865 17:75043650-75043672 TTTTTCCAGAGGCACATGGAGGG - Intronic
1151874574 17:76859659-76859681 TCTTTCCCAAAGCACAGGGAGGG - Intergenic
1152503783 17:80732490-80732512 TTTTTCCTAAAAAAGATGCATGG - Intronic
1153388497 18:4527796-4527818 TTCTTCTTAGGGCAGATGGAAGG + Intergenic
1153808980 18:8735185-8735207 GTTTTCCTAAAGCAAATCCAAGG + Intronic
1155535282 18:26810408-26810430 ATTTTCCAAAAGCAGAGGGAAGG + Intergenic
1156055544 18:32998570-32998592 TCTGTCTTCAAGCAGATGGAAGG - Intronic
1156107956 18:33688853-33688875 TTTTTTCAAAAGACGATGGAGGG - Intronic
1156354365 18:36328781-36328803 TTTTGGCTGAAGCAGCTGGAAGG + Intronic
1156768992 18:40696941-40696963 TTTTTCATAAAACAGCTGCATGG + Intergenic
1157542863 18:48524596-48524618 TGCTTCCTAAAGGAAATGGATGG - Intergenic
1158421197 18:57296169-57296191 TATTTCCAAAAGCAGACGGTGGG + Intergenic
1158997450 18:62937455-62937477 TTTTTTCTAAAAGAGCTGGAGGG - Intronic
1159092084 18:63860905-63860927 TTTCTCCTCAAGCAGAGGGAAGG + Intergenic
1159185313 18:64964333-64964355 TGTTTCCTTAAGCATAGGGAAGG + Intergenic
1159236880 18:65686974-65686996 TTTTTCAAAAAGCATAAGGAAGG + Intergenic
1159731432 18:72033170-72033192 CCTCTCCTCAAGCAGATGGAAGG + Intergenic
1159896543 18:74002041-74002063 TTTCTCCTCAAGCAGAAGGAAGG + Intergenic
1164466834 19:28494237-28494259 GTTTTCATAAAGGAGATGAATGG - Intergenic
1164558114 19:29269072-29269094 ATTTTCCTAAAGCACAGGAAAGG + Intergenic
1166408397 19:42540050-42540072 TCTCTCCTTAAGCAGAAGGAGGG + Intronic
1166897759 19:46034714-46034736 TTTTTTGTAAAGTAGATGCATGG - Intergenic
1202711518 1_KI270714v1_random:21873-21895 ATTTCCCTAAAGAAGATGGCCGG + Intergenic
925409006 2:3628125-3628147 TTTTTCCAACAGTGGATGGAGGG - Intronic
926174424 2:10576896-10576918 TTTTTCCTTAAGCAGTAGTAGGG - Intronic
926601979 2:14855012-14855034 TTTCTCCTCTAGCAGGTGGAAGG - Intergenic
926739827 2:16102019-16102041 TTTTTTCTAATTCACATGGAGGG + Intergenic
928468102 2:31542157-31542179 CCTTTCCTTAAGCAGATGGTGGG - Intronic
928818666 2:35332372-35332394 TTTTTTCTAACCCTGATGGAGGG + Intergenic
929744171 2:44638472-44638494 TTTCACGTAAAGCAGATGGCAGG - Intronic
930228905 2:48823862-48823884 TTTTCCCTAAAGAAGATCAATGG + Intergenic
930285709 2:49424896-49424918 TTTTGCCTAAAGCAGAATAATGG - Intergenic
930446219 2:51475722-51475744 TTTTTCATATAATAGATGGATGG - Intergenic
930895490 2:56441009-56441031 TCTTTCCTCAAGTAGAAGGAAGG + Intergenic
931122761 2:59238606-59238628 TTTATCCTAAAGGACAGGGAAGG + Intergenic
931391537 2:61848350-61848372 TTTAACCTAAAACAGATGAATGG + Intronic
931505998 2:62926940-62926962 TTTGTCCAAAAACAGATGAATGG + Intronic
931810093 2:65846165-65846187 TCATTCCTAAAGCAGCTGGGGGG - Intergenic
932192641 2:69753805-69753827 TTTCTCCTAAGGAAGAAGGAAGG + Intronic
932921210 2:75917033-75917055 TCTCTCCTTAAGCAGAAGGAAGG + Intergenic
933162807 2:79044766-79044788 CTTCTCCTCAAGCAGAAGGAAGG - Intergenic
934114503 2:88773124-88773146 TTTTTTCCAAATGAGATGGAAGG + Intergenic
936511340 2:113150006-113150028 TTTCTCCTCAAGCAGAAGGAAGG + Intergenic
937628291 2:124068697-124068719 CTTCTCCTCAAGCAGAAGGAAGG - Intronic
938302160 2:130223982-130224004 TTTTGCCTAAAGCTGATACATGG - Intergenic
938454518 2:131450283-131450305 TTTTGCCTAAAGCCGATACATGG + Intergenic
938978975 2:136507655-136507677 TGATTCCTAAGGCAGAAGGATGG - Intergenic
939716167 2:145586920-145586942 TATTTTCTAAAGTAGATGGTTGG - Intergenic
940169400 2:150811205-150811227 TTTTTCTTAAATTTGATGGAAGG - Intergenic
940928496 2:159396179-159396201 TTTTTCTAATAGCAGATGTAAGG - Intronic
941354209 2:164468695-164468717 CAGCTCCTAAAGCAGATGGAAGG - Intergenic
941595388 2:167470596-167470618 TCTTTCCTGAAGCAGAAGGAGGG + Intergenic
942063739 2:172251150-172251172 TTTTTCCTAGAGCAATGGGAAGG + Intergenic
942257533 2:174119155-174119177 TTTTTATTACAGGAGATGGAAGG - Intronic
944657707 2:201892407-201892429 TATTTTCTTAAGCAGCTGGAAGG + Intronic
945061619 2:205914107-205914129 TGTTTCTTCAAGCAGAGGGAGGG - Intergenic
945185878 2:207139128-207139150 TGTTTTCTAGAGAAGATGGATGG - Intronic
945970681 2:216227781-216227803 GTGTTCTTAAAGCAGATGCATGG + Intergenic
946639631 2:221769719-221769741 TTTTTCCTAAAGAGTTTGGAAGG + Intergenic
947231695 2:227893964-227893986 TTTCTCCCCAAGCAGATGGAGGG - Intronic
947237030 2:227951483-227951505 TTTTTTTAAAAGCAGATGTAGGG - Intergenic
1168836126 20:878488-878510 TTTTCCCTCTAGCAGGTGGAGGG - Intronic
1168944585 20:1742035-1742057 TTTTTCCTTAAGCAGATGAAAGG - Intergenic
1169041158 20:2496761-2496783 TTTTGCCTGGAGCAGTTGGAAGG + Intronic
1169136381 20:3200263-3200285 TTTTCCCTAAGGCAGACTGAGGG - Intronic
1174041969 20:47706531-47706553 TATTTACTAAAACAAATGGAGGG + Intronic
1174216906 20:48922403-48922425 GTTTCCCTAAACCAGTTGGACGG - Intronic
1176917508 21:14644262-14644284 TCTCTCCTCAAGCAGAAGGAAGG - Intronic
1177168904 21:17633819-17633841 TTCTTCATAAGGCAGAGGGAAGG - Intergenic
1178750711 21:35300377-35300399 TTTTTCCTGAATCATGTGGAAGG + Intronic
1179026870 21:37686292-37686314 TTTAGACTGAAGCAGATGGAGGG + Intronic
1179172767 21:38985453-38985475 TTTTTCCTCAAACACATGCATGG - Intergenic
1179652444 21:42820441-42820463 TGTCTCCTCAAGCAGAAGGAAGG - Intergenic
1179977381 21:44876110-44876132 TTTTTCCCAAAGTAGAGGCAGGG - Intergenic
1180597926 22:16991296-16991318 TTTTTCCTGAGGCAGATATATGG - Intronic
1181716811 22:24737182-24737204 TTTCTCCTGAAGCAGAAAGAAGG - Intronic
1184415702 22:44350699-44350721 AGTTTCCCAAAGCAGATGGCTGG - Intergenic
1185175076 22:49321776-49321798 CGTTTCCCACAGCAGATGGAAGG - Intergenic
949353123 3:3146322-3146344 GTTTTCATTAAGCAGATGTATGG + Intronic
950238012 3:11340645-11340667 ATTGTCCTAAAGCAGTTGGATGG + Exonic
951702052 3:25506729-25506751 TATTTACAAAAGCAGATGAAGGG + Intronic
952811952 3:37411933-37411955 CTGCTCCTAAAGCAGAAGGAAGG + Intronic
953828017 3:46270927-46270949 TTTTTCATGAAGCAGATGGTGGG + Intergenic
955029636 3:55203847-55203869 TTTTTAAAAAAGCAGAGGGAGGG + Intergenic
955794806 3:62624389-62624411 TTTTTTCTGAAACATATGGATGG - Intronic
956038239 3:65118681-65118703 TAATTCCTGAAGCAAATGGATGG - Intergenic
959370035 3:105512085-105512107 TTTTTTCTAAAGCATTTTGAGGG + Intronic
960176914 3:114528449-114528471 TTTTTCCTAAAGAAGAAATATGG + Intronic
960313252 3:116142812-116142834 TTTTTATTAAGGCAGATTGAAGG + Intronic
960593719 3:119389698-119389720 ATTTTCAGAAAGCAGATTGATGG - Intronic
960658911 3:120036825-120036847 TTTTTCCTAAAACTGCTAGATGG - Intronic
960869958 3:122238666-122238688 TCTCTCCTTAAGCAGAAGGAAGG - Intronic
961174187 3:124820523-124820545 TTATTCTTAAACAAGATGGAAGG + Intronic
961952237 3:130762212-130762234 TTTCTCCTCAAGCAGAAGGAAGG - Intergenic
962320489 3:134386307-134386329 GTTTTTCTAAAGCATATGGATGG - Intergenic
962638855 3:137361908-137361930 CTTTTCCTCAAGTAGAAGGAAGG + Intergenic
963473113 3:145769280-145769302 TTTTGAGTAAAGCAAATGGAGGG - Intergenic
963515245 3:146300912-146300934 GTTCTCCTCAAGCAGAAGGAAGG - Intergenic
964140828 3:153397056-153397078 TCTCTCCTCAAGCAGAAGGAAGG + Intergenic
964253651 3:154749843-154749865 TTTGTCCTCAAGCAGAAGGAAGG - Intergenic
964362830 3:155916211-155916233 TTTTTCATAAAGTAGATACATGG + Intronic
966306725 3:178544374-178544396 ATTTTTCTAAAGCACATGGTGGG + Intronic
967055985 3:185828678-185828700 TTTTTTCTTAATCACATGGAGGG + Intergenic
969521393 4:7679762-7679784 TTTTTTTTACAGCAGATGCAGGG + Intronic
969780731 4:9400917-9400939 TTGTTCCTAAAGCAAATGGCTGG + Intergenic
971327861 4:25658690-25658712 TTTTTACTAAAGCCCAGGGAGGG - Intronic
971383607 4:26122884-26122906 TATTTACAAAAGCAGATGGTGGG + Intergenic
972278504 4:37581649-37581671 CTTTTCCTCAAGCACAAGGAAGG + Intronic
972801332 4:42478687-42478709 GTTTTCCTAGAACAGAGGGAAGG + Intronic
974353051 4:60774234-60774256 CCTTTCCTAAAGCAGAAAGAGGG + Intergenic
974697188 4:65391029-65391051 TTTTTCATAAGGCAGCAGGAAGG + Intronic
974999430 4:69202850-69202872 TTTATCCCAAAGAAAATGGAAGG - Intronic
975180502 4:71338974-71338996 TTTTTCATACAGCAGTGGGAGGG - Intronic
975335405 4:73170171-73170193 TTTTCTCTCAAGCAGAAGGAAGG - Intronic
975464213 4:74691235-74691257 TTTTACCTAGAGCAGATAGTAGG - Intergenic
975888380 4:78993338-78993360 TATTTCTTAAAGCAGATGATGGG - Intergenic
976265400 4:83183605-83183627 TTTTTCTTCAAGCAGATTCATGG - Intergenic
976601104 4:86938016-86938038 TTTTTTGAAAAGCTGATGGAAGG + Intronic
977341504 4:95764162-95764184 TGTCTCCTAAAGCAGAAGGAAGG - Intergenic
977854753 4:101875995-101876017 CCTTTCCTAAAGCAGAGGGAAGG - Intronic
978628709 4:110717814-110717836 TTTTAACTAAACCAAATGGAGGG + Intergenic
978679439 4:111361344-111361366 TTTTTTCTAAATCTGATGGCTGG - Intergenic
978898176 4:113915753-113915775 TTTTACCTGCAGCAGATGAAGGG - Intronic
979113569 4:116791332-116791354 CTTTGCCTAAAGCAAATTGAAGG - Intergenic
979413415 4:120406531-120406553 CCTTTCCTCAAGCAGAAGGAAGG - Intergenic
980172451 4:129306144-129306166 TTTCTCCTTAAGCATAAGGAAGG + Intergenic
980723585 4:136728201-136728223 CTTCTCCTCAAGCAGAAGGAAGG + Intergenic
981332238 4:143524869-143524891 GTTTTTCAAAAGGAGATGGAGGG + Intronic
981794360 4:148579373-148579395 TATTTCCCAATGAAGATGGAAGG - Intergenic
981898525 4:149834243-149834265 TTATTCCAAAATCACATGGAAGG + Intergenic
982899572 4:160981199-160981221 TCTTCCCTTAAGCAGAAGGAAGG + Intergenic
983593263 4:169438479-169438501 TTTTACCAAAAGCAGAAAGAAGG - Intronic
983895244 4:173074491-173074513 TCTTCCCTAAAGCAGATGGATGG + Intergenic
984068561 4:175082147-175082169 TCTCTCCTCAAGCAGAAGGAAGG + Intergenic
984248471 4:177303873-177303895 GTTTGCCAAAAGGAGATGGATGG - Intergenic
984536839 4:180986438-180986460 TTTTACTTAAAGCAGATTAAAGG - Intergenic
984569212 4:181371215-181371237 TGTATCCTCAAGCAGATGGTAGG - Intergenic
984793505 4:183635926-183635948 GCTTTCCTTCAGCAGATGGACGG + Intergenic
985140621 4:186836886-186836908 TATTTGCTAAAGCAATTGGAAGG + Intergenic
985359107 4:189153587-189153609 TATTTACTAAAGCAGGTGGTGGG - Intergenic
988096725 5:26623146-26623168 TGTTTACTAAAGCTAATGGAGGG + Intergenic
988949092 5:36240586-36240608 CTTTTCCTAAAGTTGGTGGATGG + Intronic
989162102 5:38401216-38401238 AATTTCCTAGAGCAGATGGAGGG + Intronic
989394390 5:40938140-40938162 TATTTCTTAAGGCAGATGGTGGG - Intronic
989534910 5:42552095-42552117 TTTCTCCTAAACCAGTTGGCTGG - Intronic
989726261 5:44589931-44589953 TATTTCCTAAAGGAGAGAGAAGG - Intergenic
990367050 5:55081577-55081599 TTTTTCCTGAAAAAGATTGAAGG - Intergenic
990777553 5:59319872-59319894 TTTTTCCAAATGCAGGTGGGAGG + Intronic
990981132 5:61603191-61603213 TTGGTCCTAAAGCAAAAGGATGG - Intergenic
991006524 5:61833200-61833222 TTTTCCCTAAAAAAGAAGGAAGG + Intergenic
991675104 5:69082888-69082910 TTTTTAATAGAGGAGATGGAAGG + Intergenic
992013067 5:72549898-72549920 TCTTTCTAAAAGCATATGGAGGG + Intergenic
992175723 5:74146970-74146992 TTTTTCTTACAGCAGATGCTGGG + Intergenic
992339208 5:75805159-75805181 TCTTTCCTAAAGCCTCTGGAGGG + Intergenic
992365820 5:76088343-76088365 TTTTTGTTATAGCAGCTGGAAGG - Intronic
992830878 5:80592439-80592461 TTTTTCATAGAGAAGATAGAAGG + Intergenic
993033235 5:82728522-82728544 TTTTTTCTAATGCATAAGGAAGG - Intergenic
993697491 5:91079031-91079053 TTTTTCCTAAAGCAGAATTGGGG + Intronic
994274764 5:97822408-97822430 CCTTTCCTTAAGCAGAAGGAAGG + Intergenic
994523364 5:100871321-100871343 TTTTTCCCAAAGAAAAAGGATGG - Intronic
994529920 5:100956427-100956449 TCTTTCCTCAAGCAGAAGGAAGG - Intergenic
994585119 5:101697611-101697633 TTTTTCACAAAGCAGCAGGAAGG - Intergenic
994969994 5:106724184-106724206 TCTCTCCAAATGCAGATGGAAGG + Intergenic
995344773 5:111099564-111099586 TTTTTGCTCAAGTAGAGGGAGGG + Intronic
995737794 5:115321230-115321252 TATTTCCCAAAACAGATGGTAGG + Intergenic
995868472 5:116718782-116718804 TTTTTCAAAATGCTGATGGAGGG + Intergenic
995957155 5:117791215-117791237 TTTTTCTTTAAGCTGATGGCAGG + Intergenic
995970702 5:117966880-117966902 ATTTTCCTAAAGCAGGCGGGTGG - Intergenic
996240169 5:121189289-121189311 TTTTACCCAAAGCAGACTGAAGG - Intergenic
998651021 5:144121779-144121801 TTTTTCATAAAGCAGATTCTGGG + Intergenic
998837186 5:146213600-146213622 TTTTTCCTAAAGCAAGTAAATGG + Intronic
999919580 5:156303868-156303890 TTTCTCCTCAAGCAGAAGGAAGG + Intronic
1000016862 5:157285539-157285561 TTTGCCCTAAGGCAGAGGGAAGG + Intronic
1000715115 5:164632928-164632950 TTTTTCACAAAGCAAATTGAAGG - Intergenic
1000727936 5:164795603-164795625 TTTTTCCTAAACCAGAGTAATGG - Intergenic
1001016211 5:168143618-168143640 TTTGCCCTATAGCAGAAGGAGGG + Intronic
1001235407 5:170025267-170025289 TATTTACAAAAGCAGGTGGAAGG - Intronic
1001261062 5:170229165-170229187 TTTTTGAGACAGCAGATGGAAGG - Intergenic
1001440713 5:171740648-171740670 TTTTTGTTACAGGAGATGGAAGG + Intergenic
1003734505 6:8863418-8863440 TTCTTTCTAAAGACGATGGAGGG + Intergenic
1003999211 6:11579532-11579554 TCTTTCCTAAAGCATATGTAAGG - Exonic
1004055914 6:12138846-12138868 TTTTTGGCCAAGCAGATGGAAGG - Intronic
1004470114 6:15921498-15921520 TATTTACAAAAACAGATGGAGGG + Intergenic
1004873851 6:19935563-19935585 TTTTTCTTTAAGCAGATTGTTGG - Intergenic
1005133922 6:22544803-22544825 TTTTTTCCAAAGTAGTTGGAAGG + Intergenic
1006018696 6:31103771-31103793 TCTCTCCTTAAGCAGAGGGAAGG + Intergenic
1006430518 6:33993062-33993084 TTTATCCTGAAGCAGGGGGAAGG - Intergenic
1007926185 6:45651553-45651575 TTATTCCCCAAGCAAATGGAAGG + Intronic
1008673084 6:53793764-53793786 TTTTAGCTATAGCAGCTGGAGGG + Intergenic
1008695060 6:54025994-54026016 ATTTTCATAAAACAGATGGGTGG + Intronic
1008940451 6:57040565-57040587 TCTTTCCTCAAACAGAAGGAAGG - Intergenic
1010252766 6:73725280-73725302 TTTGCCCTATAGCAGAAGGAGGG + Intronic
1010343164 6:74781174-74781196 TCTCTCCTCAAGCAGAAGGAAGG - Intergenic
1010543909 6:77126316-77126338 TTTTGACAACAGCAGATGGATGG - Intergenic
1010596465 6:77769593-77769615 ACCTTCCTCAAGCAGATGGAAGG - Intronic
1010726634 6:79342498-79342520 TTTTTCACAAGGCAGCTGGAAGG + Intergenic
1011386344 6:86802313-86802335 TCTCTCCTTAAGCAGAAGGATGG + Intergenic
1011713668 6:90081462-90081484 TTTTTCCTACAGCAATTGAAGGG - Intronic
1011839112 6:91474322-91474344 TGTTTCCTAACACAGATAGACGG + Intergenic
1012100599 6:95081642-95081664 TTTTATTTAAAGCAGATGGTTGG - Intergenic
1012678873 6:102153733-102153755 TTTCTTCTCAAGCAGAAGGAAGG - Intergenic
1012892061 6:104907976-104907998 TTTTTCCTCAAGCAGAAAGAAGG - Intergenic
1013026256 6:106275971-106275993 TATTTACAAAAGCAGATGGCTGG + Intronic
1013908506 6:115246336-115246358 TCTCTCCTCAAGCAGAGGGAAGG - Intergenic
1014016461 6:116536532-116536554 TTTTTACTAACTCAGAGGGAGGG + Intronic
1014358455 6:120443222-120443244 AATATTCTAAAGCAGATGGATGG + Intergenic
1015297364 6:131611821-131611843 TTTTTCCTAAAGCAGATTGATGG - Intronic
1016135160 6:140532144-140532166 CTTCTCCTCAAGCAGAAGGAAGG - Intergenic
1017243494 6:152196682-152196704 TCTTTTCTCAAGCAGAAGGAAGG + Intronic
1017748520 6:157468619-157468641 TTTATGATAAAGCAGATAGAAGG + Intronic
1018094722 6:160375153-160375175 TTTTTCCTGAAAGAAATGGAAGG + Intronic
1018442014 6:163822143-163822165 GTTTTCCTAAAAGAGATGAAAGG - Intergenic
1018590359 6:165413424-165413446 TTTTTCATAAAGCAGCTTAAGGG - Intronic
1019012757 6:168855349-168855371 GTTTTCCTAAAGCAGATGAGTGG + Intergenic
1019935911 7:4257822-4257844 TTTTTCACAATGCAGCTGGAAGG - Intronic
1020363015 7:7350045-7350067 TTTATCTTAAAGAATATGGAGGG + Intergenic
1020558215 7:9695626-9695648 TTTTTCCTCAAGCAAATGAGTGG - Intergenic
1020574879 7:9913590-9913612 TCTCTCCTCAAGCAGAAGGAAGG + Intergenic
1020918629 7:14232486-14232508 TCTTCCCTAAAGCAAATGCATGG - Intronic
1021536285 7:21708500-21708522 TTTGACCTAAAGCAGACAGAGGG + Intronic
1021987294 7:26109082-26109104 TTTTTCCAAATTGAGATGGATGG - Intergenic
1022409245 7:30124139-30124161 TTTTTCCTAAAGCAGTAGATGGG + Intronic
1022691788 7:32663256-32663278 TTTTCCTTAAAACAGGTGGAGGG + Intergenic
1024374834 7:48625096-48625118 TTTTTCCTAAAAAAAATGAAAGG + Intronic
1024483516 7:49890106-49890128 CTGTTCCTAAAGGAGATGTATGG - Intronic
1024518279 7:50280168-50280190 TTTTTTCTAAAGCAAATGTTTGG + Intergenic
1027456316 7:78396249-78396271 TTTTTCCTGAATCACATGGGAGG - Intronic
1027674381 7:81141495-81141517 TCTATCCTCAAGCAGAGGGAAGG - Intergenic
1027951212 7:84819124-84819146 TTTTTTCTAAAGCACATTCAGGG - Intergenic
1028266638 7:88733909-88733931 CCTTTCCTCAAGCAGAGGGAAGG + Intergenic
1029007754 7:97228472-97228494 ATTTTCCTAAAGAAGAAGGATGG + Intergenic
1029933841 7:104401755-104401777 TTATTCCAAAAACAGATAGAAGG + Intronic
1030016773 7:105230471-105230493 ATCTTTCTAAAGCACATGGATGG - Intronic
1030067489 7:105671448-105671470 TTTTTCCTAAAGTAGGTGAGTGG - Intronic
1031306207 7:120130719-120130741 TCTCTCCTCAAGCAGAGGGAAGG - Intergenic
1031332947 7:120488406-120488428 TTCGTCCTGAAGCAGAGGGATGG - Intronic
1032888800 7:136170808-136170830 TTTTTCCTACAGCAACTGGTAGG - Intergenic
1032902483 7:136325111-136325133 TTTTTTCAAAAGCAGTTGTAAGG - Intergenic
1033224636 7:139551118-139551140 TTTGTCTCCAAGCAGATGGAAGG + Intergenic
1033670775 7:143490719-143490741 ATTTTCTTAATGCAGATGTATGG - Intergenic
1034943905 7:155249785-155249807 TCTATCCTAAAGAACATGGAAGG + Intergenic
1034947792 7:155274712-155274734 TATTTCTTAAAGCACATGAATGG + Intergenic
1035405834 7:158596570-158596592 CTTTTACTAAGGCAGAGGGAGGG + Intergenic
1036278167 8:7374850-7374872 TTGTTCCTAAAGCAAATGGCCGG + Intronic
1036343355 8:7937041-7937063 TTGTTCCTAAAGCAAATGGCCGG - Intronic
1036838695 8:12097803-12097825 TTGTTCCTGAAGCAAATGGCTGG - Intergenic
1036860483 8:12344047-12344069 TTGTTCCTGAAGCAAATGGCTGG - Intergenic
1037454000 8:19045714-19045736 TTTTGGCTAAATCAGATGGCTGG - Intronic
1037650970 8:20838263-20838285 TGTCTCCTTAAGCAGATGGGAGG + Intergenic
1037891297 8:22625063-22625085 ATTTTCCTGAAGCAGCTGGTTGG - Intronic
1038006827 8:23437604-23437626 TTTTACCTAATACAGATGGAAGG + Intronic
1039282201 8:35997920-35997942 TCTTTCCTCCAGCAAATGGAAGG + Intergenic
1039387883 8:37152555-37152577 TTTTTGCTGGAGCAGATGCAAGG - Intergenic
1039647515 8:39303768-39303790 TCTTTCCTAAAGCGGAGGGAGGG + Intergenic
1041947528 8:63462829-63462851 TTTTTCCTGAAGGAAATGGGAGG - Intergenic
1043625615 8:82254218-82254240 TTTTTGCTATAGCAGAAGCATGG + Intergenic
1044241415 8:89892850-89892872 CCTTTCCTCAAGCAGAAGGAAGG - Intergenic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1044742193 8:95339523-95339545 GTTTTCCCAGAGCGGATGGAAGG - Intergenic
1045733487 8:105267893-105267915 CCTCTCCTTAAGCAGATGGAAGG + Intronic
1045751338 8:105487632-105487654 TATTTACAAAAGCAGATGGAGGG + Intronic
1045787511 8:105939124-105939146 TTTTTCCTAGAGCTGATGCTGGG - Intergenic
1045860166 8:106807489-106807511 TTTTTCTTAAAGCAGAATCATGG - Intergenic
1046979191 8:120318314-120318336 GTTTGCCTAGAGGAGATGGAAGG + Intronic
1047289616 8:123518073-123518095 TATTTACAAAAGCAGGTGGAGGG + Intronic
1047948137 8:129903343-129903365 TCTTTCCTTAAACAGATAGAAGG - Exonic
1048059993 8:130909056-130909078 TCTTTCTTAAAGATGATGGATGG - Intronic
1048629444 8:136226035-136226057 CTTTTTCTAAAGTGGATGGAGGG + Intergenic
1049877221 8:145032520-145032542 TTGTTCTTAAGGCAGATGGGAGG - Intergenic
1049961879 9:744905-744927 TTGTTCCTGAAGCAGATGGCAGG + Intronic
1050238871 9:3613234-3613256 CCTTTCCTCAAGCAGAAGGAAGG + Intergenic
1050717087 9:8542144-8542166 TTTTTCCAAAAGCAAATGAAAGG + Intronic
1050989149 9:12125082-12125104 TTTTATCTTAAGCAAATGGATGG + Intergenic
1051465003 9:17367585-17367607 CTCCTCCTCAAGCAGATGGAAGG - Intronic
1051841068 9:21398946-21398968 GTTCTCCTGGAGCAGATGGATGG - Intergenic
1052257573 9:26476510-26476532 TTTTTCCAAACACAGAAGGATGG - Intergenic
1052497169 9:29241724-29241746 TTTTTCCTTAAAGAGATGCAAGG - Intergenic
1053400184 9:37812207-37812229 TTGTTTTTAAAGCAGTTGGAAGG - Intronic
1053458671 9:38251453-38251475 TCTTCCCTAAAGCAGACAGATGG - Intergenic
1055886526 9:81069810-81069832 TCTCTCCTTAAGCAGAAGGAAGG + Intergenic
1058603249 9:106693707-106693729 TTTTTTCTAAAGCAGAACAAAGG + Intergenic
1061672131 9:132194654-132194676 TATCTCCTTAAGCAGATGGGGGG - Intronic
1062165944 9:135107226-135107248 CTCTTCCTGAAGCAGATGCAAGG - Intronic
1185498547 X:578867-578889 TCCTCCCTAAAGCAGAAGGAAGG - Intergenic
1185887462 X:3795684-3795706 TTTGTCCTAAAGCAGAAAGGCGG + Intergenic
1186272636 X:7905793-7905815 TATTTACTGAAGCAGATGGTGGG - Intronic
1187652127 X:21420783-21420805 TTTCTCCTCAAGCGGAAGGAAGG + Intronic
1187942459 X:24395164-24395186 TTTTTCCTAAAGCAGGACTATGG + Intergenic
1188750043 X:33893784-33893806 TCTCTCCTCAAGCAGAAGGAAGG + Intergenic
1188786928 X:34358256-34358278 TTTGTTCTAAGGGAGATGGAAGG - Intergenic
1190015049 X:46819600-46819622 CCTCTCCTCAAGCAGATGGAAGG - Intergenic
1190444751 X:50513417-50513439 AATGTCCTAAAGCAGATGAATGG + Intergenic
1191829547 X:65401675-65401697 ACTCTCCTAAAGCAGAAGGAAGG - Intronic
1192088102 X:68121763-68121785 CTTTTCCTCAAGCAGAAGGAAGG - Intronic
1192676155 X:73199007-73199029 TGTCTCCTCAAGCAGAGGGAAGG - Intergenic
1193246870 X:79239384-79239406 CTTTTCCTTAAGCAGAAAGAAGG + Intergenic
1193650260 X:84122933-84122955 TTCCTCCTTAAGCAGAAGGAAGG - Intronic
1193751994 X:85357179-85357201 TTTTTCCTTAAGTGGATGGAAGG - Intronic
1193933319 X:87583406-87583428 CCTTTCCTAAATCAGAAGGAAGG - Intronic
1194795815 X:98210342-98210364 CCTTTCCTCAAGCAGAAGGAAGG - Intergenic
1194857928 X:98956824-98956846 TATCTCCTCAAGCAGAAGGAAGG + Intergenic
1195749986 X:108154550-108154572 TATTTACAAAAGCAGGTGGAGGG + Exonic
1196063128 X:111432648-111432670 ATTTTACTAAAGCAGATATATGG + Intergenic
1196153971 X:112406743-112406765 CCTCTCCTCAAGCAGATGGAAGG - Intergenic
1196564159 X:117185355-117185377 TTTTTGATAAAGCAGAAGCAGGG + Intergenic
1197268095 X:124397511-124397533 TTTTTGCTGAAGAAGTTGGAAGG + Intronic
1197465414 X:126799063-126799085 CCTTTCCTCAAGCAGATGGAGGG - Intergenic
1197853486 X:130889758-130889780 TGTTTCCCTAAGCAGTTGGAAGG - Intronic
1197960524 X:132000565-132000587 TTTATCCCAAAGAAGTTGGAGGG + Intergenic
1198647814 X:138828784-138828806 TGTTTTATAAAGCAGATGGCGGG - Intronic
1198694823 X:139324689-139324711 CTTCTCCTCAAGCAGAAGGAAGG - Intergenic
1199018530 X:142847927-142847949 TCTCTCCTCAAACAGATGGAAGG + Intergenic
1199795463 X:151191462-151191484 TCTCTCCTCAAACAGATGGAAGG - Intergenic
1199890800 X:152078325-152078347 TTTTTCCTAAATTAGAAAGAAGG - Intergenic
1199974933 X:152888736-152888758 TGTGTCCTGAAGCAGATGAAAGG - Intergenic
1201062055 Y:10055039-10055061 TTGTTCTTAGAGCAGATGGGAGG - Intergenic
1201914463 Y:19167582-19167604 TTGTTCTTAAGGCAGATGGGAGG - Intergenic
1202163835 Y:21965769-21965791 TTTTTCTGAAAACAGATGAAGGG + Intergenic
1202174551 Y:22085455-22085477 TTTGTCCTTAAGGAGATGGGAGG - Intronic
1202216809 Y:22500927-22500949 TTTGTCCTTAAGGAGATGGGAGG + Intronic
1202227521 Y:22620595-22620617 TTTTTCTGAAAACAGATGAAGGG - Intergenic
1202315603 Y:23575059-23575081 TTTTTCTGAAAACAGATGAAGGG + Intergenic
1202326378 Y:23695143-23695165 TTTGTCCTTAAGGAGATGGGAGG - Intergenic
1202544394 Y:25974911-25974933 TTTGTCCTTAAGGAGATGGGAGG + Intergenic
1202555165 Y:26095015-26095037 TTTTTCTGAAAACAGATGAAGGG - Intergenic