ID: 1130983664

View in Genome Browser
Species Human (GRCh38)
Location 15:88830286-88830308
Sequence ATAAAGAAACGGGCTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1201
Summary {0: 1, 1: 1, 2: 8, 3: 82, 4: 1109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130983664_1130983670 8 Left 1130983664 15:88830286-88830308 CCTTCCCCAGCCCGTTTCTTTAT 0: 1
1: 1
2: 8
3: 82
4: 1109
Right 1130983670 15:88830317-88830339 ATAGTCATGCAACATTTAACAGG 0: 1
1: 0
2: 6
3: 14
4: 134
1130983664_1130983671 9 Left 1130983664 15:88830286-88830308 CCTTCCCCAGCCCGTTTCTTTAT 0: 1
1: 1
2: 8
3: 82
4: 1109
Right 1130983671 15:88830318-88830340 TAGTCATGCAACATTTAACAGGG 0: 1
1: 0
2: 8
3: 22
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130983664 Original CRISPR ATAAAGAAACGGGCTGGGGA AGG (reversed) Intronic
900367487 1:2317141-2317163 GTAGAGAGACGGGGTGGGGATGG - Intergenic
901095070 1:6671988-6672010 ATAAAAAAACTGGCTGGGTATGG - Intronic
901383182 1:8888713-8888735 ATAAAAAAATAGGCTGGGCATGG + Intergenic
901523068 1:9800427-9800449 ATACATAAAGGGGCTGGGCATGG + Intronic
901624118 1:10613942-10613964 ATAAAGACAAGGGCAGGAGATGG - Intronic
901723756 1:11222620-11222642 ATAAAGAACTTGGCTGGGCATGG - Intronic
901762028 1:11478066-11478088 TTAAAAATAAGGGCTGGGGATGG + Intergenic
901813588 1:11781292-11781314 ATAAAGAGACTGGTTGGGGCCGG - Intronic
901912645 1:12472999-12473021 GTAAAGAAACAGGTTGTGGAAGG + Intronic
902040569 1:13489430-13489452 ATAAAGGAGAGGGGTGGGGAGGG - Intronic
902229628 1:15019677-15019699 ATGAAGAAACTGGCTGGGCTTGG - Intronic
902308014 1:15558159-15558181 AAAAAAAAAAGGGCTGGGTATGG - Intronic
902511044 1:16967351-16967373 ATAGAGGGACAGGCTGGGGAGGG - Intronic
902905904 1:19557331-19557353 ATAAAGAAATTAGCTGGGCATGG - Intergenic
903131167 1:21280360-21280382 ATAAAGAAACAGACTGGGGTGGG + Intronic
903376609 1:22870348-22870370 ATAAGGAAACGGGTTGGGAGAGG + Intronic
903401416 1:23053539-23053561 ATATAAAAACTGGCTGGGTATGG - Intronic
903463333 1:23534460-23534482 ATAAACAAACAGGCCGGGCACGG + Intergenic
903548242 1:24140607-24140629 CTCAAGGAAGGGGCTGGGGAGGG + Intronic
903632790 1:24789225-24789247 ATATAGAAACAGGCTGGGCGAGG + Intronic
903640321 1:24855185-24855207 AAAAAGAAATGTGCTGGGCATGG - Intergenic
903806894 1:26012001-26012023 AAAAAGAAATGGGCGGGGGGGGG + Intergenic
903854323 1:26327654-26327676 AAAAAAAAAAGGGCTGGGCATGG + Intronic
904060934 1:27709816-27709838 ATAAATAAATGGGCTGGGCGTGG - Intergenic
904088720 1:27929634-27929656 ATAAATAAATAGGCTGGGCATGG - Intergenic
904229322 1:29054692-29054714 ATAAAAAAACTAGCTGGGTATGG + Intronic
904514804 1:31046094-31046116 AAAAAAAAAAGGGCTGGGGGCGG + Intronic
904516214 1:31057432-31057454 AAAAAAAAAAGGGCTGGGCATGG + Intronic
904639893 1:31917958-31917980 AAAAAAAAAAGGGCTGGGCACGG + Intronic
904664059 1:32106617-32106639 AGAAAGAAATGGGCTGGACATGG - Intergenic
904689139 1:32280747-32280769 CTAAAGAAAAGAGCTGGGGCCGG - Intronic
904691595 1:32297249-32297271 AGAAAAAAATGGGCTGGGCATGG + Intronic
904810030 1:33157474-33157496 ATAAGGAAGGGGGCTGGGAAAGG - Intronic
904850843 1:33458197-33458219 ATAAAGCAATGGGCCGGGCACGG - Intergenic
905152620 1:35943589-35943611 AAAAAAAAAAGGGCTGGGGGTGG - Intronic
905161286 1:36036984-36037006 ATAAAGAATTTGGCTGGGCACGG - Intronic
905236149 1:36550685-36550707 AAAAATAAACTGGCTGGGTATGG + Intergenic
905407005 1:37740593-37740615 ATAAAGCAACTGGCTGGGCACGG - Intronic
905424223 1:37870263-37870285 ATTAAGAAATGAGCTGGGTATGG - Intronic
905654272 1:39675982-39676004 AAAAAAAAACCGGCTGGGCACGG - Intergenic
905736514 1:40331390-40331412 ATACAAAAACGAGCTGGGCATGG - Intergenic
905833900 1:41099742-41099764 ATAAGGAAACGGGCTCAGAAAGG - Intronic
906077242 1:43060987-43061009 AAAAAAAAAAGGGCTGGGGGCGG + Intergenic
906107684 1:43304696-43304718 CTGAAGAACCGGGCAGGGGAAGG + Intronic
906264649 1:44418691-44418713 ATGAGGAAAGGGGGTGGGGAGGG - Intronic
906313408 1:44769900-44769922 AAAAAGAAAAAGGCTGGGCACGG + Intergenic
906428809 1:45737614-45737636 ATAGAAAAATTGGCTGGGGATGG - Intronic
906433312 1:45773743-45773765 ATAAATAAATGAGCTGGGCATGG + Intergenic
907034449 1:51204048-51204070 ATAAAAAAATTGGCTGGGCATGG + Intergenic
907052291 1:51337715-51337737 AAATAGAAAGGGGCTGGGCACGG - Intronic
907215236 1:52858104-52858126 ATTAAGATACAGGCTGGGCATGG + Intronic
907270903 1:53290609-53290631 GTAAAGAACCGGGCTGGGGATGG - Intronic
907319827 1:53595197-53595219 AGGAAGAGAAGGGCTGGGGAGGG + Intronic
907620097 1:55968684-55968706 AGAAGGAAACGGGCTGTGGGAGG - Intergenic
907941691 1:59094511-59094533 AGAAAAAAACAGGCTGGGCATGG + Intergenic
908273896 1:62449172-62449194 ATAAAGAAACTGGCCGGGCATGG - Intronic
908295345 1:62707225-62707247 ATAGGGAAGGGGGCTGGGGAGGG + Intergenic
908440225 1:64146183-64146205 AGAAAGAAATGGGCTGGGCTTGG + Intronic
908440764 1:64151580-64151602 AGAAAGAAATGGGCTGGGCTCGG + Intronic
908488875 1:64623244-64623266 ATAAAAAAATGAGCTGGGCATGG + Intronic
908845122 1:68316736-68316758 AAAAAAAAAAGGGCTGGGCACGG + Intergenic
909017093 1:70392055-70392077 ATAATGACTCTGGCTGGGGAGGG - Intergenic
909286560 1:73827115-73827137 AAAAAGAAACTGGCTGGGCACGG + Intergenic
909287370 1:73836923-73836945 AAAAAAAAAAGGGCTGGGCACGG + Intergenic
909375465 1:74936425-74936447 ATAATGGAAGGGGCTGGGCACGG - Intergenic
909469528 1:76011640-76011662 AAAAAGAAACAGGCCGGGCAAGG + Intergenic
909671907 1:78198755-78198777 ATAAAAATAGGGGCTGGGCATGG - Intergenic
909724748 1:78820905-78820927 ATAAAAAATAGGGCTGGGTATGG - Intergenic
909867199 1:80687627-80687649 ACAAAGAAAAGGACTTGGGAGGG - Intergenic
910434493 1:87191447-87191469 AAAAGGAAATGGGCTGGGCAGGG - Intergenic
910505975 1:87950610-87950632 AGAAAGAAAGGGGCTGGGGAGGG + Intergenic
910509996 1:87992786-87992808 ATACAGAAATTGGCTGGGTACGG + Intergenic
910692928 1:89983234-89983256 AAATAGAAACAGGCTGGGCACGG - Intergenic
911214616 1:95178551-95178573 AAAAAAAAAAGGGCTGGGCATGG - Intronic
912240818 1:107906372-107906394 ATAACAAATCGGGCTGGGCACGG + Intronic
912929277 1:113942049-113942071 ATAAATAAATAGGCTGGGCACGG - Intronic
913307997 1:117452149-117452171 ATACAGAAACTCGCTGGGCATGG + Intronic
914713344 1:150234856-150234878 TTAAAGAGACGGGGTTGGGAGGG - Intronic
915384117 1:155473788-155473810 ATAAATAAAGAGGCTGGGAATGG - Intronic
915385636 1:155489478-155489500 AAAAAAAAAAGGGCTGGGCACGG + Intronic
915407653 1:155673697-155673719 ATAAAAAAATTAGCTGGGGATGG - Intronic
915417414 1:155752687-155752709 ATAAAAAAGAGGGCTGGGCATGG + Intronic
916658846 1:166902148-166902170 AGAAAGAAACTGGCTGGGCCTGG - Intergenic
916718626 1:167465619-167465641 AGAAAGAAAGGGGCTGGGTGCGG - Intronic
916737834 1:167623677-167623699 ATAAAAAAATTGGCTGGGCACGG - Intergenic
917103325 1:171467683-171467705 AAAAAAAAAAGGGCTGGGCATGG - Intergenic
917106861 1:171501052-171501074 ATAAATAAACTAGCTGGGTATGG - Intronic
917327518 1:173848141-173848163 ATGAAGAAAAGGGCCGGGCACGG - Intronic
917870511 1:179237843-179237865 AAAAAAAAAAGGGCTGGGCATGG + Intergenic
917908287 1:179612294-179612316 ATAAAGCAATGGGCAGGGGTGGG - Intronic
918059267 1:181047605-181047627 ATAAATAAATAGGCTGGGCACGG + Intronic
918063835 1:181086079-181086101 ATGAAGAAACTGGCAGGGCATGG - Intergenic
918410945 1:184257240-184257262 AAAAAGAAACAGGCCGGGCATGG - Intergenic
918559059 1:185842572-185842594 ATAAAAAAATTGGCTGGGCATGG + Intronic
918681653 1:187362687-187362709 CCAAAGAAGTGGGCTGGGGAAGG + Intergenic
919064389 1:192675019-192675041 AAAAAGAAAGTGGCTGGGCATGG - Intergenic
919659145 1:200226455-200226477 ATAAAGAAAAGGCCCGGGGAAGG + Intergenic
919895352 1:202006427-202006449 AAAAAAAAATGGGCTGGGCACGG + Intergenic
920147655 1:203875945-203875967 AGAAAGAAAGAGGCTGGGCATGG - Intergenic
920360760 1:205414578-205414600 ATAAAAAAACTGGCTGGGTGTGG - Intronic
921058850 1:211565520-211565542 AAAAAAAAACAGGCTGGGGGTGG + Intergenic
921080519 1:211735514-211735536 ACAAAGAAAAGGGGAGGGGATGG - Intergenic
921115688 1:212088794-212088816 AGAAAGAAGCTGGCTGGGCACGG + Intronic
922517443 1:226218829-226218851 ATGAAGTAACGGGCTGGGCGCGG + Intergenic
922525575 1:226300393-226300415 ATAAAGAAATTAGCTGGGCATGG + Intronic
923162484 1:231327704-231327726 ATAAGGAAAGAGGCTGGGCATGG - Intergenic
923205547 1:231755329-231755351 AAAGAGAAAGGGGCTGGGCATGG - Intronic
923657964 1:235934842-235934864 ATAAAAAAACTAGCTGGGCATGG - Intergenic
923768734 1:236918089-236918111 ATAAATAAATAGGCTGGGCATGG - Intergenic
924012156 1:239677029-239677051 AAAAGGAAATGGGATGGGGAGGG - Intronic
924054548 1:240112562-240112584 ATAAAGATAAGGGCAGGAGACGG - Intronic
924224347 1:241908504-241908526 ATTAAGATATGGGCTGGGCATGG + Intergenic
924231932 1:241969620-241969642 ATAAAAAAACTAGCTGGGCATGG + Intergenic
1062775462 10:142379-142401 TTAAAAAAACAGGCTGGGCAAGG - Intronic
1063215739 10:3923906-3923928 AGAAAGAAACCAGCTGGGCATGG - Intergenic
1063442510 10:6084372-6084394 ACAAAAAAACTAGCTGGGGATGG + Intergenic
1064051267 10:12061610-12061632 AAAAAAAAAAGGGCTGGGCATGG + Intergenic
1064271459 10:13870022-13870044 ATTAGGAGAGGGGCTGGGGAAGG + Intronic
1064420456 10:15186297-15186319 AGAAAGAAACTGGCTGGGCATGG - Intergenic
1064495566 10:15906439-15906461 ATACAGAAACTAGCTGGGCATGG - Intergenic
1064585896 10:16838934-16838956 AAAAAGAAAAGGGCTGGGTGTGG - Intronic
1064951262 10:20853630-20853652 ATAAAGAAATCAGCTGGGCATGG + Intronic
1064973857 10:21093357-21093379 AAAAAGAAATGGGCTGGAGAAGG + Intronic
1065551273 10:26870634-26870656 AGAAAGAAAGGGGGAGGGGAAGG + Intergenic
1065571903 10:27079865-27079887 ATAAATAAATAGGCTGGGCACGG + Intronic
1065791128 10:29261958-29261980 ATAAATAAACAGGCTGGGCATGG - Intergenic
1065832391 10:29626732-29626754 ATAAAGAATCAGGCTGGGCGCGG + Intronic
1065917051 10:30361449-30361471 AGAAAGAAACAGGTGGGGGAGGG - Intronic
1065931908 10:30487389-30487411 ATAAAGAAATAGGCTGGGTGTGG - Intergenic
1066249278 10:33617221-33617243 CTAAAGAAGGGGGTTGGGGAGGG + Intergenic
1067361005 10:45578454-45578476 ATAAATAAATGGGATGTGGAGGG + Intronic
1068082372 10:52335435-52335457 ATAAACAAACAAGCTGGGAATGG + Intergenic
1068672794 10:59741086-59741108 ATAAAGAAATAGGCTGGGACTGG - Intergenic
1068861468 10:61852110-61852132 ATAAATATACAGGCTGGGCATGG - Intergenic
1068929675 10:62576569-62576591 ACAAAAAAACCGGCTGGGCATGG + Intronic
1068982894 10:63080058-63080080 ATACAGAGACGGGGTGGGGGAGG - Intergenic
1069087309 10:64156290-64156312 AGAAATGAACGGGCTGGGGAAGG - Intergenic
1069623404 10:69851808-69851830 ATACAAAAACTAGCTGGGGATGG - Intronic
1069668218 10:70179169-70179191 AAAAATAAACAGGCTGGGCACGG + Intergenic
1069930704 10:71879767-71879789 AGAAAAAAAAGGGCTGGGCACGG - Intergenic
1070029838 10:72666340-72666362 ATACAGAAACTAGCTGGGCATGG + Intergenic
1070121438 10:73581135-73581157 ATAAAAAATTGGGCTGGGCATGG + Intronic
1070248023 10:74749976-74749998 AGAAAGAAATGGGCTGGGAGCGG + Intergenic
1070296236 10:75163736-75163758 AGAAAGAAAGAGGCTGGGCATGG - Intronic
1070526675 10:77301536-77301558 ATAAAGAAAAGAGCTTGGTATGG - Intronic
1071957998 10:90779910-90779932 ACCAAGAAAAGGGTTGGGGATGG - Intronic
1072337523 10:94411800-94411822 ATAAAAAAACTAGCTGGGCATGG + Intronic
1072464541 10:95650976-95650998 ATACAAAAACTGGCTGGGCATGG + Intronic
1072533831 10:96344457-96344479 AAAAAAAAAAAGGCTGGGGATGG + Exonic
1072580638 10:96736912-96736934 AAAAAGAATGGGGATGGGGAGGG - Intergenic
1072735940 10:97879840-97879862 AAAGAGAAAGGGGGTGGGGACGG + Intronic
1073005506 10:100321056-100321078 ATATAAAAACTGGCTGGGCATGG + Intronic
1073039768 10:100595517-100595539 ATACAGAAATGAGCTGGGCATGG + Intergenic
1073132973 10:101202396-101202418 AAAAAAAAAAGTGCTGGGGAAGG - Intergenic
1073145657 10:101279801-101279823 ATAAAAAGACTGGCTGGGCATGG - Intergenic
1073244325 10:102078782-102078804 AGAAAGAAAAGGGAAGGGGAGGG + Intergenic
1073345056 10:102776706-102776728 CTGAAGAATGGGGCTGGGGAAGG + Intronic
1073709650 10:106022141-106022163 ATAGAGAAAAGGGGTGGGGGTGG + Intergenic
1073813327 10:107175725-107175747 AGAAATAAACTGGCTGGGCACGG - Intergenic
1073871607 10:107871240-107871262 AAAAAAAAACGGGCTGGGCACGG + Intergenic
1074263872 10:111881738-111881760 ATAGAGAAGTGGGCTGGGGACGG + Intergenic
1074495006 10:113972335-113972357 AAAAAGACAGGGGCTGGGGTAGG + Intergenic
1074587231 10:114780047-114780069 ATAAATAAAAGGGCTGTGGCTGG + Intergenic
1074587697 10:114784372-114784394 AGAAAGAAATGGGCCGGGCATGG + Intergenic
1074692145 10:116015935-116015957 AGAAAGAAACGGAATGGTGAGGG + Intergenic
1075377859 10:121993924-121993946 AAAAAGAAAGGGGCTGGGTGTGG - Intronic
1075557099 10:123441515-123441537 ATCAAGAATGGGGCTGGGGGAGG + Intergenic
1075771307 10:124939019-124939041 ATAAAAAAATTGGCTGGGCATGG + Intergenic
1075807865 10:125203005-125203027 AAAAAGAATCAGGCTGGGCACGG + Intergenic
1076197728 10:128532209-128532231 ACAAAGACACGGCCTGGCGATGG - Intergenic
1077193810 11:1268986-1269008 AAAAAAAAAAGGGCTGGGCACGG - Intergenic
1077521353 11:3037289-3037311 AGAAAGAAACATGCTGGCGAAGG + Intronic
1078107928 11:8370351-8370373 ATTAAGAAATGAGCTGGGGGTGG - Intergenic
1078129620 11:8602498-8602520 ACAAAAAAACAGGCTGGGCATGG - Intergenic
1078178996 11:8994398-8994420 ATAAAGAAAAGGGCTAAGGATGG + Intronic
1078219892 11:9343055-9343077 AAAAAAAAACAGGCTGGGCACGG + Intergenic
1078225544 11:9388463-9388485 ATAAATAAATAGGCTGGGCATGG - Intronic
1078777278 11:14405239-14405261 AAAAAAAAAAGGGCTGGGCACGG + Intergenic
1078841915 11:15085202-15085224 ATAAAAAAATTGGCTGGGCATGG + Intergenic
1080460721 11:32452425-32452447 AAAAAGAATCGGGCTGGGCGCGG + Intergenic
1080487779 11:32728993-32729015 AAAAAGAATTGGGCTGGGCAGGG - Intronic
1080636623 11:34129897-34129919 ATAAAGAAAGTGGCCGGGCATGG - Intronic
1080877122 11:36286257-36286279 TTAAAAATACGGGCTGGGCATGG + Intronic
1081843527 11:46221019-46221041 ATAAATAAATGGGCCGGGTATGG + Intergenic
1081903087 11:46646617-46646639 ATAAAGAAACTAGCTGGGCATGG - Intronic
1082016328 11:47491151-47491173 ATAAAGAAATAGGCTGGGCACGG - Intronic
1082070170 11:47933284-47933306 AAAAAAAAAAGGGCTGGGCACGG + Intergenic
1082262098 11:50084358-50084380 ATAAAAAAATTGGCTGGGCACGG - Intergenic
1082839856 11:57680092-57680114 AAAATGAAACTGGCTGGGCATGG + Intronic
1083356787 11:62072416-62072438 AGAAAGAGACGGGCTGGGCGCGG - Intergenic
1083409062 11:62479455-62479477 AAAAAAAAAGGGGCTGGGCAGGG - Intronic
1083502439 11:63122668-63122690 ATAAAAAAACTAGCTGGGCATGG - Intronic
1083577191 11:63800721-63800743 AGAAAGAAAGGGGCCGGGCAGGG + Intergenic
1083794308 11:65005900-65005922 ATAAATAAATAGGCTGGGCATGG + Intergenic
1083865876 11:65452567-65452589 AAAAAGAAAAAGGCTGGGGAGGG - Intergenic
1084007085 11:66328868-66328890 ATAAGGACAAAGGCTGGGGAAGG + Intergenic
1084037117 11:66518740-66518762 AAAAAGAAAAGGGCTGGGCGTGG - Intronic
1084102805 11:66960919-66960941 ATTAAAAAATGGGCTGGGCACGG + Intergenic
1084135192 11:67173545-67173567 ATACAAAAACTGGCTGGGCATGG - Intronic
1084196888 11:67527992-67528014 ATAAATAAAATGGCTGGGCATGG - Intergenic
1084203153 11:67575782-67575804 ATAAACAAACAGGCTGGACATGG + Intergenic
1084287235 11:68140201-68140223 ATACAAAAATGGGCTGGGCATGG + Intergenic
1084326244 11:68401842-68401864 AAAAAAAAACGAGCTGGGCATGG - Intronic
1084489331 11:69469876-69469898 ATAAAGAAATGAGCTGGGCATGG - Intergenic
1084629771 11:70340281-70340303 ATAAAGAAATTAGCTGGGCATGG + Intronic
1084913249 11:72408375-72408397 AGAAAGAACCGGGCTGGGTGCGG + Intronic
1085187593 11:74589556-74589578 ATAAATAAACAGGCTGGGCACGG + Intronic
1085192990 11:74645200-74645222 AGAAAGAAACAGGCTGAGGTAGG + Intronic
1085362849 11:75907667-75907689 ATAAAGAAATTGGCTGGGCATGG - Intronic
1085778482 11:79387712-79387734 ATAAACAAACAGGCTGGGTGTGG + Intronic
1085801705 11:79595715-79595737 AGGATGAAACGGGCTGGGCATGG - Intergenic
1086110109 11:83190284-83190306 AAAAAGAAACAGGCCGGGCATGG - Intergenic
1086344927 11:85886567-85886589 ATAAAGAAATGGGCGGGTGGGGG + Intronic
1086524250 11:87705876-87705898 ATAAAAACACTGGCTGGGCATGG - Intergenic
1086888684 11:92230582-92230604 ATAAATAACAGGGCTGAGGACGG - Intergenic
1087115231 11:94517857-94517879 AAAAAAAAATGGGCTGGGCACGG + Intergenic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1087838285 11:102896800-102896822 TTAAAAAAATGGGCTGGGCATGG + Intergenic
1087937894 11:104056837-104056859 ATAAAAAAACCGGCTGGGCATGG + Intronic
1088017451 11:105078029-105078051 ATAAAAAAATTGGCTGGGCATGG - Intronic
1088165993 11:106938091-106938113 ACAAAAAAACGAGCTGGGCATGG - Intronic
1088242153 11:107783888-107783910 ATGAAGAAAGGGGCCGGGCACGG + Intergenic
1088271957 11:108043051-108043073 AAAAAGAAACAGGCCGGGCATGG - Intronic
1088416241 11:109592132-109592154 ACAAAGAAACGGGCTGGTGTTGG + Intergenic
1088632276 11:111785208-111785230 ATAAGGAAACAGGCTGCGGGTGG - Intronic
1088668204 11:112115801-112115823 AGGGAGAAAGGGGCTGGGGATGG + Intronic
1088722669 11:112608315-112608337 ATACAGAACCTGGCTGGGAAGGG + Intergenic
1089226468 11:116927025-116927047 AAAAAAAAAAGGGCAGGGGAGGG + Intronic
1089438889 11:118497686-118497708 ATAAAAAAATGAGCTGGGTATGG - Intronic
1089506140 11:118963447-118963469 AAAAACAAACAGGCTGGGTATGG - Intergenic
1090061255 11:123465983-123466005 ATAAAGATTTGGGCTGGGCATGG + Intergenic
1090416261 11:126542629-126542651 ATAAAGACAGGAGATGGGGAAGG - Intronic
1090833707 11:130438546-130438568 AGAAAGAAAGGGGAAGGGGAAGG - Intergenic
1090984218 11:131751294-131751316 ATAAATAAAAAGGCTGGGCACGG + Intronic
1091435754 12:471414-471436 ATAAATAAATAGGCTGGGCACGG + Intronic
1091460610 12:641542-641564 CTAAAGAAACAGGCTAGGGCCGG + Intronic
1091610656 12:2004667-2004689 AGAAAGAAACGGGATGCAGAGGG - Intronic
1091690970 12:2597198-2597220 AAAAAGGAACAGGGTGGGGATGG - Intronic
1091755815 12:3050743-3050765 AGCAAGAAAGGGGCTGGGCATGG - Intergenic
1092351841 12:7762078-7762100 AAAAAAAAAAGGGCTGGGCATGG - Intergenic
1092518639 12:9242373-9242395 ATAAAGGAAAGGGAAGGGGAGGG - Intergenic
1092877998 12:12865163-12865185 AGATAGGAAAGGGCTGGGGAGGG + Intergenic
1092883051 12:12902775-12902797 AGAAAAAAAAGGGCTGGGCACGG + Intronic
1093352875 12:18126047-18126069 AATAAGAAACAGGCTGGGCATGG - Intronic
1093411244 12:18870038-18870060 ATATTGAACCTGGCTGGGGATGG + Intergenic
1093823938 12:23658600-23658622 ATACAGAAACCAGCTGGGCATGG + Intronic
1093865797 12:24226220-24226242 ATGAATAAAAGGGATGGGGATGG - Intergenic
1095586164 12:43852139-43852161 ATACAAAAACTGGCTGGGCACGG + Intronic
1096050686 12:48605007-48605029 ATAAAAAAATTGGCTGGGCATGG - Intergenic
1096055080 12:48643923-48643945 ATACACAAACTGGCTGGGTATGG - Intergenic
1096126415 12:49123076-49123098 ATAAAGAATCTGGCTGGGCCAGG + Intergenic
1096141805 12:49248571-49248593 AAAAAGAAAAGGGCCGGGCACGG + Intronic
1096187630 12:49592491-49592513 ATAACAAAACAGGCTGGGCATGG + Intronic
1096294109 12:50369198-50369220 ATAGATAAATGGGCTGGGCACGG + Intronic
1096475320 12:51906114-51906136 ATAAATGAAAAGGCTGGGGAGGG - Intergenic
1096494814 12:52033838-52033860 ATAAGGAGAGGGGCTGTGGAAGG - Intronic
1096654980 12:53083787-53083809 AAAAAAAAACGGGCTGGGCATGG + Intergenic
1096665648 12:53162277-53162299 ATAAATAAATAGGCTGGGTACGG + Intronic
1096719153 12:53508228-53508250 AAAAAGATACAGGCTGGGCATGG - Intronic
1096862069 12:54536506-54536528 ATAAATAAACTAGCTGGGCAGGG + Intronic
1096864350 12:54552972-54552994 ATAAATAAATGAGCTGAGGATGG - Intronic
1097006409 12:55922027-55922049 AAAAAAAAACGAGCTGGGTAAGG - Intronic
1097119677 12:56721480-56721502 ATAAAGAAAGGGGGAGGGGGAGG + Intronic
1097251498 12:57635192-57635214 TAAAAGAAACAGGCTGGGCACGG + Intergenic
1098862135 12:75722054-75722076 ATATAGAAACAGGCTCGGAAAGG + Intergenic
1098996657 12:77128548-77128570 AAACAGAAACAGGCTGGGCATGG + Intergenic
1099880158 12:88458457-88458479 AAATAGAAACTGGCTGGGCATGG + Intergenic
1100429893 12:94522026-94522048 ATAAAGAAAACAGCTGGGTATGG + Intergenic
1101241114 12:102841100-102841122 ATGAGGAAACAGGCTTGGGAAGG + Intronic
1101720950 12:107350395-107350417 AAAAAGAAATGGGCTGGGCGTGG + Intronic
1101845297 12:108358664-108358686 AGAAAGAGAAGGGCTGGGGAGGG + Intergenic
1101890611 12:108711387-108711409 AGAAAGAAAAGGGCCGGGCATGG + Intronic
1101918454 12:108913939-108913961 ATGAAGAAATGGGCTGGGCATGG - Intronic
1101986802 12:109453481-109453503 ATAAAGAAAAGGACTGAGCATGG - Intronic
1102314646 12:111877307-111877329 AAAAAAAAACAGGCTGGGCATGG - Intronic
1102384932 12:112500880-112500902 ATAAAAAATAGGGCTGGGCATGG - Intronic
1102477324 12:113196934-113196956 ATGCAGAAACGGGCTTGGGAAGG + Intronic
1103316433 12:120059698-120059720 ATAAATAAATAGGCTGGGCAGGG - Intronic
1103350462 12:120279928-120279950 ACAAAAAAACGGGCCGGGCATGG - Intergenic
1103398256 12:120624639-120624661 AAAAAAAAATGGGCTGGGCACGG - Intergenic
1103569521 12:121835527-121835549 ATAAAAAAACTAGCTGGGTATGG - Intergenic
1103731290 12:123029296-123029318 ATAAAGAAACTGGCTGTGCATGG + Intronic
1103831400 12:123782364-123782386 AGAAAGAAAAGGGAAGGGGAGGG - Intronic
1104359075 12:128115133-128115155 ATGAAGAAATGGGCTGGGTGTGG - Intergenic
1104389941 12:128383641-128383663 ACAAAGACAAGGACTGGGGAAGG - Intronic
1105033561 12:132902118-132902140 AAAAAAAAAAGGGCTGGGCACGG - Intronic
1105377696 13:19860591-19860613 ATACAAAAATGGGCTGGGCATGG - Intronic
1106205576 13:27590517-27590539 AAAAAAAACCGGGCTGGGGATGG - Intronic
1106313113 13:28570934-28570956 ATAAAGAATCTGGCTGGGCACGG - Intergenic
1106787017 13:33117399-33117421 ATAAACACATGGGCTGGGCATGG - Intronic
1107258931 13:38467578-38467600 CTGAAGAAACGTGCTGGAGAAGG - Intergenic
1107347051 13:39472899-39472921 ATAAAGAAGGGGGCCGGGCACGG - Intronic
1107938507 13:45364747-45364769 AAAAAAAAACCGGCTGGGCACGG - Intergenic
1108006694 13:45954174-45954196 AAAAAAAAAAGGGCTGGGCATGG + Intergenic
1108419893 13:50237945-50237967 ATGTAGAAAGGGGATGGGGAAGG + Intronic
1108823007 13:54376723-54376745 ATAAAAAATCAGGCTGGGCATGG + Intergenic
1109447772 13:62466709-62466731 ATGAAGAAATCGGCTGGGTAAGG + Intergenic
1109799512 13:67358009-67358031 ATAAAGAAACAGGCCGGGCGCGG - Intergenic
1110113744 13:71784643-71784665 ATAAAGAAAAGGGTAGGAGAGGG - Intronic
1111193099 13:84834910-84834932 ATAAAGATAAGGCCTGGGAAAGG - Intergenic
1111295211 13:86268878-86268900 AGAAAGAAAAGGGGAGGGGAGGG - Intergenic
1111817134 13:93168009-93168031 AGAAACAAATGGGCTGGGCATGG - Intergenic
1111955606 13:94753993-94754015 ATTAAGAAATAGGCTGGGCATGG - Intergenic
1111976515 13:94971826-94971848 TTAAAGACTGGGGCTGGGGACGG + Intergenic
1111990057 13:95107634-95107656 ATAAAGATATAGGCTGGGCATGG + Intronic
1112177091 13:97036558-97036580 AAAAAGAAAAGGGGAGGGGAGGG + Intergenic
1112250956 13:97779892-97779914 GGAAAGAAAAGGGCAGGGGAGGG + Intergenic
1112313676 13:98342406-98342428 ATAAACAAACTGGCTGGGTACGG + Intronic
1113514704 13:110885260-110885282 AAAAAAAAAAGGGCTGGGCATGG + Intronic
1113654411 13:112058808-112058830 AGAGAGAAAGGGGTTGGGGAAGG + Intergenic
1113811931 13:113148037-113148059 ATAAAAAAACAGGCTGGGTGTGG + Intronic
1113846130 13:113392835-113392857 TAAAAAAAACGGGCTGGGCACGG + Intergenic
1114367547 14:22046306-22046328 AGAAAGTAAGGGGCTGTGGAGGG + Intergenic
1114441500 14:22751925-22751947 AAAAAAAAAAGGGCTGGGCATGG - Intergenic
1114463406 14:22902928-22902950 ATAAAAAAACTAGCTGGGCATGG - Intronic
1114554286 14:23552582-23552604 ACAAAAAAACGGGCTGGGCGCGG - Intronic
1114651215 14:24285691-24285713 ATAAATTAACAGGCTGGGCACGG + Intergenic
1115553262 14:34523513-34523535 AAAAAAAAACGGGCTGGGCGTGG - Intronic
1115564500 14:34613500-34613522 ATACAGAATCTGGCTGGGCATGG + Intronic
1115596036 14:34909913-34909935 ATAAAAATACAGGCTGGGCATGG + Intergenic
1115840394 14:37462931-37462953 ATAAGGTAACAGGCAGGGGATGG - Intronic
1116001094 14:39243573-39243595 ATGAAGAACCAGGCTGGGGGTGG + Intronic
1116362281 14:44015011-44015033 AAAAAGAAAAGGGAAGGGGAGGG + Intergenic
1116504671 14:45664083-45664105 AAAAAAAAATGGGCTGGGCACGG - Intergenic
1116948747 14:50859567-50859589 TTAAAGAGAAGGGTTGGGGAGGG - Intronic
1116957196 14:50936651-50936673 ATACAGAAATGAGCTGGGCAAGG + Intronic
1117105378 14:52393023-52393045 ATTAAGAAACCAGCTGGGCATGG - Intergenic
1117313083 14:54547884-54547906 TTAAAGAACCAGGCTGAGGAAGG - Intergenic
1117392835 14:55278975-55278997 ATAAAGAAACAGGGTGGGCATGG - Intronic
1117538157 14:56721375-56721397 AAAAATAAAGGGGCTAGGGAAGG + Intronic
1117702167 14:58425084-58425106 ATAAAGAAAAGGGGTTGAGAGGG + Intronic
1117828132 14:59724731-59724753 AAAAAAAAACAGCCTGGGGAAGG + Intronic
1117914199 14:60660079-60660101 ATACAGAAATTGGCTGGGCATGG + Intergenic
1117981949 14:61350338-61350360 ACAAAGAAACAGGCGGGGCAAGG - Intronic
1117983376 14:61363748-61363770 AGAAGGCAACGGGCAGGGGATGG + Intronic
1118014878 14:61649969-61649991 ATAAAAAAATTGGCTGGGCATGG + Intronic
1118168707 14:63363554-63363576 ACAAAAAAAGGGGCAGGGGAGGG - Intergenic
1118197433 14:63640805-63640827 ATAAAGAAAACGGCCGGGCACGG + Intronic
1118594182 14:67423359-67423381 ATGAAGAAGCTGGCTGTGGAGGG - Intergenic
1118954474 14:70467443-70467465 ATAAAGAAATTGGCTAGGCATGG - Intergenic
1119044179 14:71302927-71302949 ATAAAGAAACTGGCCAGGTATGG - Intergenic
1119328775 14:73778368-73778390 AAAAAAAAACGTGATGGGGAAGG + Intronic
1120194686 14:81468746-81468768 ATAAAGAACTGGGCAGGGCATGG - Intergenic
1120461239 14:84799009-84799031 CTAAAGAAAGGGGCTGAGCAGGG + Intergenic
1120592742 14:86394992-86395014 AAAAAGAAAAAGGCTGGGCACGG + Intergenic
1120889927 14:89482752-89482774 ATAAAGAAATTAGCTGGGCATGG + Intronic
1121123765 14:91392969-91392991 AAAAGGAAAGGTGCTGGGGAAGG + Intronic
1121645057 14:95512560-95512582 ATAAATAAATAGGCTGGGCACGG + Intergenic
1121672046 14:95717713-95717735 AAAAAAAAACAGGCTGGGCACGG - Intergenic
1121729719 14:96178061-96178083 ACAGAGAAACAGGCAGGGGAGGG + Intergenic
1121883032 14:97517302-97517324 GTAAAGAAGAGGGTTGGGGAAGG - Intergenic
1122215083 14:100197986-100198008 AAAAACAAACTGGCTGGGCACGG - Intergenic
1122910460 14:104825430-104825452 GTAAAGAATCGGGCCGGGCACGG + Intergenic
1123761222 15:23434347-23434369 ATAAAAAAACTAGCTGGGCATGG - Intergenic
1124068223 15:26365943-26365965 ATAAAGAAATGAGCTGGGCACGG - Intergenic
1124352472 15:28967726-28967748 ATAAAGAAAGGGGCCGGGCGCGG - Intronic
1124897473 15:33790281-33790303 ACAAACAAAAGGGCTGGGCAAGG - Intronic
1125201667 15:37105822-37105844 CCAAAGAAAAGTGCTGGGGATGG - Intergenic
1125460140 15:39898633-39898655 GTAAAGAGACGAGCTAGGGAGGG + Intronic
1125561046 15:40633826-40633848 ATAACGATAAGGGCTGGGCATGG - Intronic
1125575144 15:40750197-40750219 AAAAAAAAACGAGCTGGGCATGG - Intronic
1125614205 15:40995246-40995268 ATAAAGGGAGGGGCTGGGAAAGG + Intronic
1125690777 15:41594515-41594537 ATAATAAAATGGGCTGGGCACGG - Intergenic
1125844370 15:42837915-42837937 ATAAAGAAACCTGCTGGGCGCGG + Intronic
1125870986 15:43101674-43101696 ACAAAAAAACTGGCTGGGCACGG + Intronic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126356314 15:47800250-47800272 ATAAAGGAATTGGCTGGGCATGG + Intergenic
1126498675 15:49320770-49320792 AAAATGAAACAAGCTGGGGAAGG - Intronic
1127067884 15:55259104-55259126 AAAAAGAACCTGGCTGGGCATGG - Intronic
1127397566 15:58554945-58554967 ACCAGGGAACGGGCTGGGGACGG - Intronic
1127485620 15:59415104-59415126 AAAAAAAAACAGGCTGGGCACGG - Intronic
1127495044 15:59502872-59502894 AAAAAGAAGCAGGCTGGGCAGGG - Intronic
1127496587 15:59518471-59518493 ATAAAAAAATGAGCTGGGCATGG - Intronic
1127611069 15:60637793-60637815 AGAAAGAAAAGGACTAGGGATGG - Intronic
1127805725 15:62518322-62518344 ATAAAGAAATGTGCTGGTGGTGG - Intronic
1127997309 15:64160938-64160960 ATAAAAAAACAGGCTGGGCATGG - Intronic
1128006177 15:64243876-64243898 ATAAATAAACAGGCCGGGCATGG + Intronic
1128055470 15:64696252-64696274 TTTAAGAAACAGGCTGGGCATGG + Intronic
1128298642 15:66547940-66547962 ATATAGAAACTAGCTGGGCATGG - Exonic
1128400371 15:67273377-67273399 AAAAAGCAATGGGCTGGGCATGG - Intronic
1128655702 15:69460280-69460302 ATAAAGAAACTGGCCGGGCATGG - Intergenic
1128734599 15:70045992-70046014 ATAAACAAATGGGCTGGGCATGG - Intergenic
1128769349 15:70270237-70270259 CCAAAGAAATGGGCTTGGGAAGG - Intergenic
1128798415 15:70481073-70481095 ATACAAAAACGTGCTGGGCATGG - Intergenic
1129083564 15:73064618-73064640 ATTAAGAAACTAGCTGGGCATGG - Intronic
1130053649 15:80504610-80504632 ATAAAAAAACAAGCTGGGCATGG + Intronic
1130546569 15:84860876-84860898 ATACAAAAACGAGCTGGGCATGG - Intronic
1130791627 15:87161437-87161459 ATAAAGATCCAGGCTGGGCATGG + Intergenic
1130983664 15:88830286-88830308 ATAAAGAAACGGGCTGGGGAAGG - Intronic
1130991235 15:88877274-88877296 ACACAGAAAAGGGCTGGGGATGG + Exonic
1131170556 15:90175132-90175154 ATACAGAAATGAGCTGGGCATGG - Intronic
1131285976 15:91057690-91057712 ATAAAAAAACTAGCTGGGCATGG + Intergenic
1131721931 15:95178926-95178948 ATATAGAAAGAGGCTGGGCATGG - Intergenic
1132133095 15:99303541-99303563 ATATAAAAACGGCCTGGGCACGG + Intronic
1132195547 15:99912213-99912235 GTAAGGAAAGAGGCTGGGGATGG - Intergenic
1132602009 16:777318-777340 ATAAATAAATAGGCTGGGCATGG + Intronic
1132822931 16:1885857-1885879 AAAAAAAAAAGGGCTGGGCACGG + Intergenic
1133464308 16:6015518-6015540 CTAAAGATATGGGCTAGGGAAGG - Intergenic
1133757311 16:8771757-8771779 AAAAAGAAAGAGGCTGGGCATGG - Intronic
1134118241 16:11565561-11565583 TTAAACAAACGGGCCCGGGATGG - Intronic
1134139327 16:11703799-11703821 GTAAAGAAGTGGGCTGGGCATGG + Intronic
1134478533 16:14597075-14597097 AGAAAAAAATGGGCTGGGCATGG - Intronic
1134674174 16:16077865-16077887 ATAAAAAAACTAGCTGGGCATGG + Intronic
1134813381 16:17186391-17186413 ATAAAGAAATCGGCTGGGCATGG - Intronic
1134903205 16:17957313-17957335 AAAAAGAAATGGGCTGGGCATGG + Intergenic
1135014217 16:18910518-18910540 ATAAAAAAATTGGCTGGGCATGG - Intronic
1135082414 16:19447707-19447729 ATAAAAAAATTGGCTGGGCATGG - Intronic
1135123539 16:19786864-19786886 AGAAAGAAAAGGGGAGGGGAGGG + Intronic
1135906091 16:26513124-26513146 ATACAGAAACTAGCTGGGCATGG - Intergenic
1136016240 16:27402880-27402902 AAAATGTAGCGGGCTGGGGAAGG + Intronic
1136105266 16:28025721-28025743 ATAAAAGAACAGGCAGGGGATGG - Intronic
1136132199 16:28230153-28230175 TTAAAGATACAGGCTGGGCACGG - Intergenic
1136331386 16:29579817-29579839 ATAAAAAAATTGGCTGGGCATGG - Intergenic
1136392953 16:29976923-29976945 ATAAAGAAACAGGCTCAGCAAGG - Intronic
1136446021 16:30319570-30319592 ATAAAAAAATTGGCTGGGCATGG - Intergenic
1136450073 16:30349364-30349386 ATAAACAAAAGGACTGGGCACGG + Intergenic
1136473552 16:30497766-30497788 AAAAAGAAAAGGGCTGGGCACGG - Intronic
1136507576 16:30714795-30714817 AAAAACAAACAGGCTGGGAACGG - Intronic
1137020490 16:35420965-35420987 AGAAAGAGAGGGCCTGGGGAAGG + Intergenic
1137033671 16:35548597-35548619 AAAAGGAGACGGCCTGGGGAAGG + Intergenic
1137428948 16:48402728-48402750 AAAAAGAAAGTGGCTGGGCACGG - Intronic
1137554526 16:49462062-49462084 AATTAGAAACGGGCTGGGCATGG + Intergenic
1138020886 16:53480279-53480301 ACAAAGCAACAGGCAGGGGATGG - Intronic
1138398475 16:56726599-56726621 ATAAACAAACAGGCCGGGCATGG + Intronic
1138752224 16:59437602-59437624 AGAAAAAAACTGGCTGGGCATGG - Intergenic
1138813408 16:60177035-60177057 TAGAAGAAACGGGCTAGGGAAGG + Intergenic
1139200685 16:64973649-64973671 ATACAAAAACTAGCTGGGGATGG + Intronic
1139331396 16:66194650-66194672 AAAAACAAACAGGCTGGGCATGG - Intergenic
1139387278 16:66580748-66580770 ATGAGGAAACAGGCTGGGAATGG - Intronic
1139387671 16:66584322-66584344 ATAAAGATACTGGCTGGGTGTGG - Intronic
1139493189 16:67298281-67298303 ACAAGGAAACGGGCTGGGCGCGG - Intronic
1139575519 16:67839580-67839602 ATAAATAAATAGGCTGGGCACGG + Intronic
1139604470 16:68008214-68008236 CTAAAGAATTGGGCTGGGCACGG - Intronic
1139628662 16:68213087-68213109 AGAAAGAAACAGGCCGGGCATGG - Intronic
1139753592 16:69124663-69124685 TTAAAGAAATCGGCTGGGGGTGG - Intronic
1139761352 16:69187089-69187111 ATAATGAATCGTGCGGGGGAGGG + Intronic
1139772699 16:69291927-69291949 ATAAATAAATAGGCTGGGCACGG + Intronic
1139898526 16:70308525-70308547 ATAAATAAATAGGCTGGGCATGG - Intronic
1140058241 16:71544590-71544612 AAAAAGAGAGGGGCTGGGGAAGG - Intronic
1140259641 16:73366439-73366461 AGAAAGACAGGGGCTGGGCATGG + Intergenic
1140484695 16:75284212-75284234 AAAAAGAAATGAGCTGGGCATGG - Intergenic
1141181364 16:81755162-81755184 ATAAAGGAACAGGCTTGGGGTGG - Intronic
1141325064 16:83049236-83049258 ATAAAGCCAGGAGCTGGGGAAGG - Intronic
1141470043 16:84231846-84231868 ATACAAAAATGTGCTGGGGATGG + Intronic
1141504280 16:84464319-84464341 ATAAAGAGTAGGGCTGGGCATGG + Intergenic
1141550675 16:84804680-84804702 AAAAAGAATCTGGCTGGGCACGG + Intergenic
1142495823 17:305820-305842 AGGAAGAAAGGGGCTGGGGAGGG - Intronic
1142729404 17:1841586-1841608 AAAAAGGAACTGGCTGGGCAAGG - Intronic
1142738206 17:1915077-1915099 AGAAAGCAGGGGGCTGGGGACGG - Intergenic
1142783054 17:2196739-2196761 ATGAAGAAAGGGGCCGGGCATGG + Intronic
1142857465 17:2739388-2739410 ATAAACAAACAGGCTGGGCGCGG + Intergenic
1143049071 17:4107752-4107774 ATAAAGAAATAGGCTGGGCATGG + Intronic
1143133492 17:4696038-4696060 AAAAAAAAACAGGCTGGGCAAGG + Intronic
1143254728 17:5547469-5547491 ATAAAGAAATGGGCTGGGGAAGG - Intronic
1143846138 17:9773876-9773898 ATACAAAAACTGGCTGGGCATGG - Intronic
1143918499 17:10312549-10312571 ACAAAGAAAGCGGCTGGGGAAGG + Intronic
1144053455 17:11517655-11517677 AAAAAGAAACTAGCTGGGCATGG - Intronic
1144446701 17:15337551-15337573 ATAAAAATATGGGCTGGGCACGG + Intronic
1144831652 17:18135154-18135176 AAACAGAAACAGGCTGGGCACGG - Intronic
1145108193 17:20137953-20137975 ATAAAATAAAGGGCTGGGTACGG - Intronic
1145115005 17:20201168-20201190 AAAAAGAAAGTGGCTGGGCACGG + Intronic
1146034800 17:29397002-29397024 AAAAAAAAAAGGGCTGGGCATGG + Intronic
1146043219 17:29477133-29477155 ATAAAAAAATTGGCTGGGCACGG - Intronic
1146174714 17:30658421-30658443 AAAAAGAAAGAGGCTGGGCACGG + Intergenic
1146176562 17:30669122-30669144 ATGCAAAACCGGGCTGGGGATGG - Intergenic
1146348174 17:32074432-32074454 AAAAAGAAAGAGGCTGGGCACGG + Intergenic
1146350024 17:32085237-32085259 ATGCAAAACCGGGCTGGGGATGG - Intergenic
1146417827 17:32653314-32653336 AAAAAGAAATTGGCTGGGCATGG + Intronic
1146513626 17:33472173-33472195 ATAAAGAAATTAGCTGGGCATGG - Intronic
1146774944 17:35605538-35605560 CTAAAGAAACTGGCTGGGCACGG - Intronic
1147117619 17:38313510-38313532 AAAAAGAAAAAGGCTGGGCATGG - Intronic
1147128869 17:38394066-38394088 ATAAACAAAGGGGCTATGGAAGG - Intronic
1147204535 17:38827232-38827254 AGAAAGAAACAGGCTGGGCTCGG + Intergenic
1147374780 17:40016966-40016988 ATAAATACATGGGATGGGGAGGG - Exonic
1147485492 17:40808569-40808591 ATATAGAAACTGGCCGGGCATGG - Intergenic
1147498214 17:40937605-40937627 ATAAAGAAGCAGTCTGGGGGCGG + Intronic
1147616742 17:41833607-41833629 ATAAAGAAACAGGCCGGGTGTGG - Intronic
1147753725 17:42754296-42754318 ACAAACAAACAGGCTGGGCACGG - Intergenic
1147846186 17:43405437-43405459 ATGAAGAAACTGGCTGGGCACGG + Intergenic
1147876758 17:43627246-43627268 ATAAAGAAACTGGTTGGGCGCGG + Intergenic
1147985335 17:44303772-44303794 AGAGAGAAACGGGCTGGGGACGG - Intergenic
1148661392 17:49336311-49336333 AAAAAAAAAAGGGCTGGGCATGG - Intronic
1149020991 17:51964047-51964069 TTAAAGTAAAGGGCTGGAGAAGG + Intronic
1149488321 17:57062664-57062686 ATACAGAAATGGGCTGGGCACGG - Intergenic
1149598853 17:57880512-57880534 ATAAAGACAAGAGCTTGGGAAGG - Intronic
1149617854 17:58016633-58016655 GTAAAAAAACAGGCTGGGCATGG - Intergenic
1149752751 17:59161591-59161613 ATAAAAAAACCAGCTGGGCATGG + Intronic
1149839958 17:59953354-59953376 ATAAAAAAACTAGCTGGGCATGG - Intronic
1149918382 17:60632989-60633011 ACAAAAAAACTGGCTGGGCACGG + Intronic
1150245300 17:63670290-63670312 ACTAAGAAATGGGCTGGGCATGG + Intronic
1150361982 17:64543562-64543584 AGAAAGAAATTGGCTGGGCATGG - Intronic
1150727816 17:67665994-67666016 ATAAAAAAATGAGCTGGGCATGG - Intronic
1150912364 17:69401785-69401807 AAAAAAAAAAGGGCTGGGCACGG + Intergenic
1151401764 17:73860288-73860310 AAAAAAAAACGGGCCGGGCACGG + Intergenic
1151580398 17:74974328-74974350 ATAAATAATAGGGCTGGGCATGG - Intergenic
1151634342 17:75334459-75334481 ATAAATAAATCGGCTGGGCACGG - Intronic
1151664778 17:75539532-75539554 AAAAAGAGATGGGCTGGGCACGG - Intronic
1151748117 17:76022358-76022380 CTGGAGAAACGGGCTGGGGCTGG + Intronic
1151783075 17:76260421-76260443 ACAAACAAACTGGCTGGGCATGG + Intergenic
1151809458 17:76429249-76429271 ATAAAAAGTTGGGCTGGGGATGG + Intronic
1151931652 17:77235991-77236013 AAAAACAAACAGGCTGGGCATGG + Intergenic
1152425502 17:80216393-80216415 ATAGAGACAGGGGATGGGGAGGG + Intronic
1152547455 17:81008874-81008896 AGAAAGAGATGGGCTGTGGAGGG - Intronic
1152881675 17:82820131-82820153 ATAAAAAAATTGGCTGGGCATGG - Intronic
1153551158 18:6262981-6263003 GTAAAGAAATGGGCTGGGCACGG + Intronic
1154052539 18:10974691-10974713 ATGAAGAAACGGGCTCTAGAGGG - Intronic
1154073141 18:11173509-11173531 ATAGAGAAAAAGGCTGGGCACGG + Intergenic
1154154605 18:11934121-11934143 AGAAAGAAACAGGCTGGGTGCGG - Intergenic
1154180054 18:12128905-12128927 ATAAAGAAATTAGCTGGGCATGG + Intronic
1154245354 18:12692158-12692180 ATACAAAAACTAGCTGGGGATGG + Intronic
1154327986 18:13405949-13405971 TTAAAGAAACGGACTTAGGAAGG - Intronic
1155054097 18:22170182-22170204 GGAACGCAACGGGCTGGGGAGGG - Intronic
1155196594 18:23480794-23480816 ATAAAAAAACTGGCTGGACACGG + Intronic
1155291926 18:24351055-24351077 ATAAAAAATCAGGCTGGGCACGG + Intronic
1155355927 18:24954140-24954162 ATCTAGATAAGGGCTGGGGAAGG + Intergenic
1155482035 18:26299149-26299171 AAAAAAAAAAGGGCTGGGCATGG - Intronic
1155795264 18:30027445-30027467 AAAAAAAAACAGGCTGGGGGAGG - Intergenic
1156142889 18:34138244-34138266 ATAAATAAATTGGCTGGGCATGG + Intronic
1156377521 18:36528131-36528153 ATAAAGGAATCAGCTGGGGATGG + Intronic
1156677273 18:39543086-39543108 AGAAACAAAGGGGCTGGGCATGG + Intergenic
1156878411 18:42044708-42044730 AAAAATAAACATGCTGGGGATGG - Intronic
1156961572 18:43038047-43038069 AAAAAAAAATGGGCTGGGCATGG + Intronic
1157071202 18:44410805-44410827 ATATGGAAAGGGCCTGGGGAGGG - Intergenic
1157230540 18:45911725-45911747 ATATAGATACTGGCTGGGCATGG - Intronic
1157822382 18:50782547-50782569 AGTAAGAAACAGGCTGGGCATGG + Intergenic
1157840964 18:50957994-50958016 ATAAATAAATAGGCTGGGCATGG + Intergenic
1157884271 18:51351327-51351349 ATGAAGAAGCTGGCTGGGCATGG - Intergenic
1158491824 18:57916798-57916820 AGACAGACATGGGCTGGGGATGG - Intergenic
1158943707 18:62430280-62430302 ACAAAGGAAGGGGCTGGGCACGG + Intergenic
1159464605 18:68765065-68765087 ATAAATAAATAAGCTGGGGATGG + Intronic
1159533864 18:69690888-69690910 ATATAGAATTGGGCTGGGCATGG + Intronic
1159812899 18:73037820-73037842 AGAAAGTAAAGGGCTGGGCACGG - Intergenic
1160854589 19:1210864-1210886 AAAAAAAAAAGGGCTGGGGCCGG + Intronic
1161416338 19:4149256-4149278 AAAAAGAAAAGGGCCGGGCATGG - Intergenic
1161423935 19:4191770-4191792 ATAAATAAATAGGCTGGGGACGG - Intronic
1161440182 19:4286897-4286919 ATTAAGAAAGGGGCTGGGTAAGG + Intronic
1161443014 19:4303226-4303248 AAAAAGATACAGGCTGGGCATGG + Intergenic
1161692185 19:5742637-5742659 AAAAAGAAATGAGCTGGGAATGG + Intronic
1161737585 19:6001156-6001178 AGAAAGAAACAGGCTGGGGATGG - Intronic
1161805936 19:6442922-6442944 AAAAAAAAAAGGGCTGGGCATGG - Intronic
1162076198 19:8189398-8189420 ATCAAGATAAGGGCTGGGCACGG + Intronic
1162103987 19:8358810-8358832 ATACACAAACAGGCTGGGCAGGG - Intronic
1162117491 19:8439838-8439860 ATATACATACGGGCTGGGCATGG + Intronic
1162125111 19:8495394-8495416 ATAAAAAAACTAGCTGGGGCCGG - Intronic
1162400215 19:10441415-10441437 AAAAAAAAAAGGGCTGGGCACGG - Intronic
1162414982 19:10530427-10530449 AAATAGAAACAGGCTGGGCATGG + Intergenic
1162822869 19:13234057-13234079 AAAAAAAAAAGGGCTGGGCACGG + Intronic
1162884141 19:13683680-13683702 AGAAAGAAACTGGCTGGGCGCGG + Intergenic
1162888172 19:13712027-13712049 AAAAAAAAAAGGGCTGGGCACGG + Intergenic
1162947023 19:14050209-14050231 ATGAAGCAAGGGGCTGGGCAAGG + Intronic
1162982261 19:14247765-14247787 ATGCAAAATCGGGCTGGGGATGG + Intergenic
1162987687 19:14281634-14281656 AAAAAGAAAAAGGCTGGGCATGG - Intergenic
1163022003 19:14486924-14486946 ATAAAGAAGCGGGCCGGGCGCGG - Intronic
1163095620 19:15055093-15055115 GTAAGGAAAGGGGCTGGGCAGGG - Intronic
1163165441 19:15494487-15494509 ATAAATAAACGGGCCGGGCGGGG - Intronic
1163256591 19:16159724-16159746 AAAAAAAAAAAGGCTGGGGACGG + Intergenic
1163257155 19:16163262-16163284 ACAAACAAACGGGCTGGGCGTGG + Intronic
1163288795 19:16365214-16365236 ATTAAGAAACAGGCTGAGGGGGG - Intronic
1163602248 19:18256139-18256161 AAAAAAAAAAGGGCTGGGCACGG - Intergenic
1163664371 19:18596246-18596268 ATCAGGAAACAGGCTGGGCATGG + Intronic
1163684651 19:18704377-18704399 AAAAAGAAAAAGGCTGGGCATGG - Intronic
1163716311 19:18874457-18874479 CTAAAGAACTGGGCTGGGCACGG - Intronic
1163716454 19:18875253-18875275 AGAAAGAAACAGGCTGGGCGCGG + Intronic
1163891458 19:20019919-20019941 AAAAAGAATAGGGCTGGGTATGG + Intronic
1164524568 19:29003922-29003944 ACAGAGAAAGGGGGTGGGGATGG - Intergenic
1165072921 19:33265867-33265889 ATACAGAAATTGGCTGGGCATGG - Intergenic
1165495182 19:36148518-36148540 AAAAAAAAAAGGGCTGGGCATGG + Intronic
1165663184 19:37600815-37600837 ATAAAGAAACTTGATGGGCAGGG - Intronic
1166196738 19:41211308-41211330 ATAAAGAGGCGGGCTGGGCACGG + Intergenic
1166624872 19:44342524-44342546 TTAAAGAAAAGGGCCGGGCACGG + Intronic
1166723474 19:45011140-45011162 ATAAATAAATAGGCTGGGCATGG - Intronic
1166776720 19:45317578-45317600 AAAAAAAAAAGGGCTGGGCACGG - Intronic
1166847197 19:45735965-45735987 AAAAAGAAATGGGCTGGGCATGG - Intronic
1166896957 19:46029320-46029342 TTAAAAAAATGGGCTGGGCATGG + Intergenic
1166921951 19:46234618-46234640 ACAAAGAAATCGGCTGGGCATGG + Intergenic
1166991442 19:46695194-46695216 ATAAATAAATGGGCTGGGCATGG + Intronic
1167228956 19:48269592-48269614 ATACAAAAACGAGCTGGGCATGG - Intronic
1167303611 19:48694594-48694616 AAAAAGAAACAGGGTGGGGCGGG - Intergenic
1167371269 19:49083768-49083790 AGAAAGAAAAGGGCTGGGTGTGG - Intergenic
1167416017 19:49373011-49373033 ATAAATAAATAGGCTGGGCATGG + Intronic
1167435836 19:49478176-49478198 ATAAATAAATAGGCTGGGCACGG + Intronic
1167459904 19:49619523-49619545 AAAAAAAAAAGGGCTGGGCATGG - Intronic
1167467064 19:49655824-49655846 ATTAAGAAATGAGCTGGGCATGG - Intronic
1167682588 19:50933432-50933454 ATGAAGAAAGGGGCCGGGCATGG - Intergenic
1167771496 19:51522843-51522865 ATAAAGAACTGGGCTGGGTGTGG + Intronic
1168034580 19:53709314-53709336 ATAAAATAACAGGCTGGGCACGG - Intergenic
1168262342 19:55203036-55203058 AAAAAAAAAAGGGCTGGGCACGG + Intronic
1168276997 19:55284173-55284195 GGCCAGAAACGGGCTGGGGAGGG + Exonic
1168286549 19:55337664-55337686 ATACAGAAACTAGCTGGGCATGG + Intergenic
1168697842 19:58415484-58415506 TAAAAGAAACAGGCTGGGCATGG - Intronic
1168715389 19:58524074-58524096 AAAAAAAAAAGGGCTTGGGACGG + Intronic
925033175 2:667002-667024 AAAAAAAAAAGGGCTGGGGGTGG - Intergenic
925832162 2:7906562-7906584 CTAAAGATCCGGGCTGTGGATGG + Intergenic
925863233 2:8200537-8200559 ATAAGGACAGGGGCTGGGCATGG + Intergenic
926034518 2:9625032-9625054 AGAATGAAATGGGCTGGGCATGG - Intronic
926182867 2:10661363-10661385 ATAAATAAATAGGCTGGGCATGG - Intronic
926189647 2:10719394-10719416 ATACAAAAACTGGCTGGGCACGG - Intergenic
926536834 2:14123430-14123452 ATATAGAGACTGGCTGGGCATGG - Intergenic
926717440 2:15936173-15936195 AAAAAAAAAAGGGCAGGGGAGGG - Intergenic
927403576 2:22742472-22742494 AACAAGAAACGTGCTGGTGAGGG - Intergenic
927535424 2:23853953-23853975 ATAAAAAAATAGGCTGGGCATGG + Intronic
927537117 2:23872164-23872186 AAACAGAAACAGGCTGGGCATGG - Intronic
927968854 2:27291197-27291219 ATAAAGAAATTAGCTGGGCATGG + Intronic
928014732 2:27645259-27645281 AAAAAAAAATGGGCTGGGGATGG - Intronic
928079838 2:28301092-28301114 ACAAAGAAACAGGGTGTGGAAGG - Intronic
928414717 2:31082727-31082749 AAAAAGAAATTGGCTGGGCACGG + Intronic
928993492 2:37261194-37261216 ATAAAGATACAGGCTGGGTGTGG + Intronic
929002166 2:37358120-37358142 AAAAAGAAACAGCCTGGGCATGG + Intronic
929471105 2:42193839-42193861 ATAAAGATACTAGCTGGGTATGG - Intronic
929608285 2:43250572-43250594 AAAAAGAAAGGGGCTGGGCATGG + Intronic
930124960 2:47788541-47788563 AAAAAGAAAAAGGCTGGGCACGG - Intronic
930670365 2:54143720-54143742 AAAAAAAAACCGGCTGGGTATGG - Intronic
930846905 2:55916398-55916420 ATGAAGCAAGGGGCTGGGCACGG - Intronic
931145524 2:59512640-59512662 ATAAAAAAAAGAGCTGGGCATGG + Intergenic
931294650 2:60910173-60910195 AAAAAGGAAGGGGCTGGGCACGG + Intronic
931327754 2:61244457-61244479 ATACAAAAATTGGCTGGGGATGG + Intronic
931734116 2:65178417-65178439 ACCAAGAAACAGGCTGGGCATGG + Intergenic
932149162 2:69353376-69353398 ATAAAAAAATTGGCTGGGGGTGG + Intronic
932161423 2:69463799-69463821 ATAAAAAAATAGGCTGGGCATGG - Intronic
932196503 2:69788545-69788567 AGAAAGAAAGAGGCTGGGCACGG + Intronic
932727656 2:74193417-74193439 ATAATGAAATGGGCTGGGCATGG - Intergenic
933625884 2:84598316-84598338 ATAAATGAACTGGCTGGGCATGG - Intronic
933708883 2:85310952-85310974 AAAAAGCAACTAGCTGGGGATGG + Intergenic
933734575 2:85485512-85485534 ATAAATAAAAGGGCCGGGCACGG + Intergenic
933800189 2:85954351-85954373 ATAAAGAAACAGGCTTGGAGAGG + Intergenic
933896392 2:86814544-86814566 AAAAAAAAAAGGGCTGGGCATGG + Intergenic
934095078 2:88594350-88594372 ATAAAAAAATTAGCTGGGGATGG - Intronic
934544492 2:95203529-95203551 ATCAAAGAACGGGCTGGGCACGG + Intergenic
934728955 2:96644186-96644208 AAAAAGAAAGAGGCTGGGCATGG + Intergenic
935305311 2:101731466-101731488 AAAATGAAATGGGCTGGGGGTGG + Intronic
935321161 2:101890743-101890765 ATAAATAAAAAGGCTGGGCATGG - Intronic
937414668 2:121704849-121704871 ATAAATAAATAGGCTGGGCATGG + Intergenic
937626506 2:124050170-124050192 ATAAAGAAATGGGCTGGGCATGG + Intronic
938185209 2:129225566-129225588 ATAAAGAGATGGGCTGGGCACGG - Intergenic
938304536 2:130243029-130243051 ATAAAAAATCAGGCTGGGCACGG - Intergenic
938683059 2:133711715-133711737 ACAAAGATAAAGGCTGGGGATGG + Intergenic
938897731 2:135768855-135768877 ATAAAAAATCAGGCTGGGCACGG - Intronic
939051928 2:137317760-137317782 AAAAAGAAATGAGCTGGGCATGG + Intronic
939191489 2:138921645-138921667 GTAAAGAAAAGGGCTGGGTGGGG + Intergenic
940203698 2:151178891-151178913 ATAAAGAAATTAGCTGGGCATGG + Intergenic
941620702 2:167775278-167775300 ATAATGAAATGGGCTGGGCGTGG + Intergenic
941828808 2:169930673-169930695 ATAAAAAAACTGGCTAGGCATGG - Intronic
942150795 2:173074955-173074977 AAGAAGAAATGGGCTGGGCATGG - Intergenic
942655194 2:178207992-178208014 ATAAAGTGCCGGGCTGGGCATGG + Intronic
942894749 2:181038910-181038932 ATAAAAAAACAGGATGAGGAAGG + Intronic
942932236 2:181508850-181508872 AGAAAGAAAAGGGCTGGGTATGG + Intronic
942932260 2:181508984-181509006 ATGAAAAAATGGGCTGGGCATGG + Intronic
943082590 2:183273632-183273654 AAAAGGAAAGGGGCTGGGCATGG - Intergenic
943264833 2:185715656-185715678 ACAAAAAATCGGGCTGGGCACGG - Intergenic
943415969 2:187604121-187604143 ATAAAGAAAGTGGATGGGCACGG - Intergenic
943636900 2:190317067-190317089 ATAAAAAAACTAGCTGGGTATGG - Intronic
944166238 2:196724578-196724600 ATAAGGAAACAAGCAGGGGAAGG + Intronic
944234714 2:197431408-197431430 AAGAAGAAAAGGGCTGGGCATGG - Intronic
944525538 2:200615159-200615181 ATAAAGAAATTAGCTGGGCATGG - Intronic
944631594 2:201631597-201631619 ATAAAGAATCAGGCAGGGGTGGG + Intronic
945071322 2:205991835-205991857 ATACAAAAACTAGCTGGGGATGG + Intergenic
946020343 2:216636019-216636041 AGAAAGAGTCGGGCTGGGGGAGG + Intronic
946090556 2:217219008-217219030 GTAGAGACAAGGGCTGGGGAGGG + Intergenic
946135768 2:217645686-217645708 GGAAAGGAAGGGGCTGGGGATGG - Intronic
946683898 2:222247142-222247164 ATAAAGACATGGACTTGGGAGGG - Intronic
947317659 2:228879160-228879182 ATAAAGAACAGGGCTGGGTGAGG + Intronic
947400624 2:229728093-229728115 ATAAATAAAGAGGCTGGGCACGG + Intergenic
947588114 2:231369581-231369603 AAAAAGAAACTGGCTGAGCATGG - Intronic
948360266 2:237414982-237415004 TGAAAGAAACAGGCTGGGCACGG + Intergenic
948394791 2:237637175-237637197 ATCAAGAATTGGGCTGGGCATGG + Intronic
948469970 2:238171080-238171102 ATAAAAAAAGGGCCTGGAGATGG + Intronic
948764033 2:240210458-240210480 ATAGAGAACGGGGCTGGGGCGGG - Intergenic
949007823 2:241660032-241660054 ATACAGAAACTAGCTGGGCATGG + Intronic
949081272 2:242101818-242101840 ATAAAGAAACAGGCTGGGCACGG - Intergenic
1168734938 20:126213-126235 ATACAAAAACTGGCTGGGCATGG - Intergenic
1169364639 20:4981989-4982011 AAAAAGAAAGAGGCTGGGCACGG - Intronic
1169402002 20:5289991-5290013 ATACAAAAATGGGCTGGGCATGG + Intergenic
1170147446 20:13192244-13192266 ATAAAGAACAGGGCCGGGAATGG + Intergenic
1170927439 20:20738258-20738280 ATAAATAAACGGGAGAGGGAAGG - Intergenic
1171362789 20:24600903-24600925 ATGAAGACATGGGCTGGGCATGG - Intronic
1172038165 20:32025106-32025128 AGAAAGAAAGGGGAAGGGGAAGG - Intronic
1172038172 20:32025141-32025163 AGAAAGAAAGGGGAAGGGGAAGG - Intronic
1172078857 20:32322316-32322338 ATAAAAATACTGGCTGGGCATGG + Intronic
1172311251 20:33920119-33920141 AAAAAAAAACAGGCTGGGCATGG - Intergenic
1172430277 20:34884907-34884929 AGAAAGAAATAGGCTGGGCATGG + Intronic
1172494687 20:35371713-35371735 AAAAAAAAACAGGCTGGGCATGG + Intronic
1172503758 20:35445677-35445699 ATAAAAAAATAGGCTGGGCATGG + Intronic
1172543137 20:35737570-35737592 ATAAAGACAGAGGCTGGGCACGG + Intronic
1172562187 20:35898899-35898921 CAAAAGAAATGGGCTGGGCATGG - Intronic
1172576045 20:36009539-36009561 AAAAGGAAACAGGCTGGGCATGG + Intronic
1172666074 20:36601198-36601220 AAAAAAGAACGGGCTGGGCATGG + Intronic
1172682536 20:36727829-36727851 ATAAAGAAATAGGCCGGGCACGG - Intronic
1173450188 20:43157059-43157081 AAAAAGACACAGGCTGGGCACGG + Intronic
1173757296 20:45528150-45528172 AGAAAGAAAAAGGCTGGGCATGG - Intergenic
1173804290 20:45913731-45913753 ATAAATAAATAGGCTGGGCATGG - Intergenic
1173962271 20:47083948-47083970 ATAAAGAAATGGGCAGGGCCAGG + Intronic
1174169091 20:48605123-48605145 GGAAAGAAAAGGCCTGGGGAGGG + Intergenic
1174234882 20:49081274-49081296 ATAAAGAAATGGGCCGGGCGTGG - Intronic
1174374995 20:50120681-50120703 AAAAAGAAACTAGCTGGGGGTGG + Intronic
1174449887 20:50613155-50613177 ATAAAGAAACAGGATGGGTGTGG + Intronic
1174462686 20:50694010-50694032 AGAAAGAAACAGGCTGAGCATGG + Intergenic
1174717349 20:52773725-52773747 ATAGAGAAATTGGCTGGGTATGG - Intergenic
1174801106 20:53563675-53563697 GGAAAGAAAAGGGCTGGGGAAGG - Intergenic
1174829862 20:53802782-53802804 AGAAATAAATGGGCTGGGCATGG - Intergenic
1174976130 20:55337420-55337442 TTAATGAAATGGGCTGGGCATGG + Intergenic
1175325163 20:58120792-58120814 ATAAAAAAACAGGCTGGGCATGG + Intergenic
1175598314 20:60253148-60253170 AGAAAGAAGCTGGCTGGAGAAGG - Intergenic
1175769430 20:61614265-61614287 GAAAAGAAAGGGGCTGGGGCTGG + Intronic
1175864890 20:62170213-62170235 AGAAAGAAAAGAGCTGGGCACGG + Intronic
1176174962 20:63716970-63716992 ATACAAAAACTGGCTGGGCATGG - Intronic
1176303257 21:5109305-5109327 ATTAAAAAACGAGCTGGGCATGG - Intergenic
1176416348 21:6477373-6477395 AAAAGCAAACAGGCTGGGGATGG + Intergenic
1176453294 21:6883446-6883468 ATAAAGAAAGGGTCTAGTGAGGG - Intergenic
1176831468 21:13748494-13748516 ATAAAGAAAGGGTCTAGTGAGGG - Intergenic
1177176084 21:17702108-17702130 ATAGAAAAACGTGCGGGGGAAGG + Intergenic
1177743437 21:25181557-25181579 ATAAAGAATCAGGCTGGGCGCGG + Intergenic
1177850134 21:26335925-26335947 GAAAAGAAACAGGCTGGGCATGG + Intergenic
1178213664 21:30568664-30568686 TTAAAGAAATGAGCTGGGTAAGG - Intergenic
1178326815 21:31653207-31653229 TTAAGGAAAGGGGCTGGGCATGG - Intergenic
1178499618 21:33115103-33115125 ATGAAAAACCGGGCTGGGCATGG - Intergenic
1178570417 21:33730688-33730710 ACAAAAAAACAGGCTGGGCACGG - Intronic
1178846139 21:36175635-36175657 ATATAAAAACGAGCTGGGTATGG + Intronic
1178975598 21:37218552-37218574 GTAAAGAGACTGGCTGGGGTTGG + Intergenic
1179202719 21:39241173-39241195 ATAAATAACAGGGCTGGGCATGG + Intronic
1179555358 21:42172115-42172137 AAAAAAAAACTAGCTGGGGAGGG - Intergenic
1179691848 21:43085708-43085730 AAAAGCAAACAGGCTGGGGATGG + Intergenic
1179711325 21:43264992-43265014 ATAAAAAAACAGGCAGGGCATGG + Intergenic
1179853771 21:44152631-44152653 ATTAAAAAACGAGCTGGGCATGG + Intergenic
1181150566 22:20880340-20880362 ATACAGAAATTAGCTGGGGATGG + Intronic
1181155116 22:20915411-20915433 AAAAAAAAAAGGGCTGGGCAAGG + Intergenic
1181300949 22:21880737-21880759 ATAAAAAAATGAGCTGGGCATGG - Intergenic
1181378711 22:22481880-22481902 ATAGAAAAACTGGCTGGGCATGG - Intergenic
1181751368 22:24991311-24991333 AGGAAGAAAGGGGCTGGGCATGG - Intronic
1181922219 22:26329175-26329197 CTAAGGAAACAGGCTGGGCACGG + Intronic
1182102967 22:27670686-27670708 AGAAAGAAGCAGGCTGGGGAAGG - Intergenic
1182273137 22:29168342-29168364 AAAAAAAAAAGGGCTGGGCACGG + Intergenic
1182282828 22:29226972-29226994 ATAGAGAAAGGGGATGGGGCAGG - Intronic
1182711551 22:32326410-32326432 ATAAAAAAACTAGCTGGGCATGG - Intergenic
1183093331 22:35538437-35538459 ATAAAGCAAGTGGGTGGGGAGGG + Intergenic
1183155793 22:36074351-36074373 ATAAAGGAATGGGCTGGGTGTGG + Intergenic
1183399130 22:37591027-37591049 AGAAAGAAAGGAGCTGGGCATGG + Intergenic
1183472444 22:38016840-38016862 AAAAAGATACAAGCTGGGGAGGG + Intronic
1183477674 22:38044793-38044815 AAAAAAAAAAGGGCTGGGCACGG - Intergenic
1183646028 22:39127252-39127274 ATAAAGCCACGGGTGGGGGAAGG - Intronic
1183791523 22:40074486-40074508 ATAAAGAAAATGGCTGGGCGCGG + Intronic
1183864772 22:40695400-40695422 ATAAACAAATAGGCTGGGCACGG - Intergenic
1183901647 22:41010148-41010170 ATACAAAAACGCGCTGGGCATGG + Intergenic
1184203204 22:42983332-42983354 AAAAAGAAACTGGCTGGGTGTGG + Intronic
1184209350 22:43026153-43026175 AAAAAAAAAGGGGCTGGGCATGG - Intergenic
1184228746 22:43146280-43146302 ATAAAAAAAAGGGCTGGGTGCGG + Intergenic
1184527353 22:45032911-45032933 ATAAAAAAACTGGCTGGGTGTGG - Intergenic
1184560630 22:45261027-45261049 AAAAAGAAAGGGGTTGGGGGAGG + Intergenic
949089724 3:12747-12769 TTAAAGACACTGGCTGGGCATGG + Intergenic
949112735 3:281848-281870 AAAAAGAAATAGGCTGGGCATGG - Intronic
949179815 3:1115457-1115479 ATAAACAAAAGGGCCGGGTACGG + Intronic
949554126 3:5137726-5137748 ATTAAAAAAAGGGCTGGGCATGG - Intronic
949764957 3:7516179-7516201 AAAAAAAAAAGGGCTGGGCACGG + Intronic
949794028 3:7826115-7826137 AAAAAAAAAAGGGCTGGGCATGG - Intergenic
950073052 3:10167703-10167725 AAAAAGAAACTGGCTGGGCGCGG - Intronic
951102821 3:18709213-18709235 AGGAAGAAATGGGCTGGGCATGG + Intergenic
951706861 3:25552383-25552405 ATAATGAAAATGGCTGGGGTTGG + Intronic
952303382 3:32124353-32124375 CTAAAGAAATGGGCCGGGGGTGG - Intronic
952417674 3:33104299-33104321 ATAAAGAAATAGGCTGGGTGCGG - Intergenic
952468231 3:33614660-33614682 TTAAGAAAACGGGCTGGGCATGG + Intronic
952716369 3:36484579-36484601 ATAAATAAAAGGCCTGGGCATGG - Intronic
953317961 3:41946023-41946045 AGAAAGAGACGGGCAGGGGGCGG + Intronic
954203203 3:49037735-49037757 AAAAAAAAAAGGGCAGGGGACGG + Intronic
954225733 3:49179845-49179867 ATCAATAAACAGGCTGGGCACGG + Intronic
954560160 3:51549787-51549809 AAAAAAAAAGGGGGTGGGGAAGG + Intronic
955249847 3:57269184-57269206 ATGGAGAAAAGGGCTGGAGAGGG + Exonic
955263405 3:57417858-57417880 AGAAAAAAACAGGCTGGGCACGG + Intronic
955366278 3:58312971-58312993 AAAAAAAAAAGGGCTGGGCACGG + Intronic
955374920 3:58386808-58386830 ATAAAACAAGAGGCTGGGGAGGG + Intronic
955772730 3:62402219-62402241 ACTAAGAAACGGGGTGGGGGCGG + Intronic
956121513 3:65970912-65970934 ATAAATAAATAGGCTGGGCACGG + Intronic
956496341 3:69830595-69830617 ATGAAGCATCGGGATGGGGAGGG - Intronic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956648402 3:71479905-71479927 AAACAGAAACAGGCTGGGTACGG + Intronic
956777112 3:72574455-72574477 ATAAAGACTCAGGCTGGGCATGG + Intergenic
957029401 3:75222475-75222497 TTAAAGACACTGGCTGGGCATGG + Intergenic
957608052 3:82429830-82429852 ATCAAGTAACTGGCTGGGCACGG - Intergenic
958683211 3:97357360-97357382 ATAAAGAAACTAGCTTGGCATGG - Intronic
958927418 3:100173890-100173912 ACAAAGAAACAGGCTGAGAAGGG - Intronic
958950335 3:100409352-100409374 ATAAATAAATAGGCTGGGCACGG + Intronic
958955419 3:100460881-100460903 ATAAAGAAATTAGCTGGGCATGG - Intergenic
959056856 3:101575461-101575483 AAAAAGACAGGGGGTGGGGAGGG - Intronic
959681828 3:109105232-109105254 ATAAAAAAATAGGCTGGGCACGG + Intronic
960038974 3:113129961-113129983 AAAAAGAAACCGGCTGGGCGTGG - Intergenic
960321905 3:116247009-116247031 ATAAAGACACGGTCAGGAGATGG + Intronic
960715236 3:120568681-120568703 AGGAAGAAACAGGCTGGGGGAGG + Intergenic
960801141 3:121541832-121541854 TTGAAGAAAAGGGCTGGGCATGG + Intronic
960872115 3:122260515-122260537 ATAAAGGAAAGGGCTCTGGAAGG + Intronic
960883677 3:122372529-122372551 ATCAAGAAAATGGCTGGGCACGG + Intronic
960959893 3:123062994-123063016 ATCAAGATACAGGCTGGGCATGG + Intergenic
961700431 3:128740080-128740102 ACAAAGAAAAGGGCTGGGCACGG + Intronic
962535319 3:136324234-136324256 GTTAAGAAACAGGCTGGGCATGG - Intronic
962871744 3:139501765-139501787 AGAAAAAAACAGGCTGGGCAAGG - Intergenic
963029869 3:140959169-140959191 ATAAAGAAATTAGCTGGGCATGG - Intronic
963145548 3:141990182-141990204 ATAATTAAAGGGGCTGGGCATGG - Intronic
964329150 3:155582036-155582058 AAAAAAAAAAGGGCTGGGCACGG - Intronic
964748000 3:160029726-160029748 AAAAAGAAAAGGGCTGGGTGCGG - Intronic
964807370 3:160625937-160625959 AAAAAGAAATTGGCTGGGCAGGG + Intergenic
964980872 3:162677213-162677235 ATAAAGAAATGGGCCAGGCACGG + Intergenic
965280532 3:166746433-166746455 ATCTAGAAATAGGCTGGGGATGG + Intergenic
965575187 3:170210756-170210778 TTAAAGAAAGGGGCTGGGCATGG + Intergenic
965577055 3:170228307-170228329 ATACAGAAAGAGGCTGGGTATGG + Intronic
965606173 3:170499588-170499610 ATAAAGAAAAGGTTTGGGAATGG - Intronic
965769102 3:172162132-172162154 ATACAGAAACTGGCTGGGCATGG - Intronic
966002042 3:174961499-174961521 ATAAAACACCGGGCAGGGGAAGG + Intronic
966180693 3:177185853-177185875 ATAAAAAAATTGGCTGGGCATGG + Intronic
966924705 3:184636754-184636776 GTAAGGAAGCGGGGTGGGGAGGG - Intronic
966948435 3:184794649-184794671 ATAAGAAAATGGGCTGGGCATGG + Intergenic
967444359 3:189548278-189548300 ATTAGGAATCTGGCTGGGGATGG + Intergenic
967912982 3:194557291-194557313 TTAAAGAAACGGGTGGGGGGAGG - Intergenic
967976615 3:195038907-195038929 ATAAAGGTAGGGGCTGGGCATGG + Intergenic
968714722 4:2147931-2147953 ATGAAAAACCGGGCTGGGCACGG - Intronic
968957319 4:3725978-3726000 ATAATGAAGGGGGCGGGGGAAGG + Intergenic
969272929 4:6115116-6115138 ATAAAAAAACAGGCTGGGTGTGG + Intronic
969300631 4:6294958-6294980 ACAGAGCAATGGGCTGGGGACGG - Intronic
970304523 4:14717988-14718010 ATGCAGAAACAGGCTGGGCACGG - Intergenic
970508974 4:16761568-16761590 ATAAGTAGACAGGCTGGGGAAGG - Intronic
970599806 4:17632778-17632800 GTAAAGGATGGGGCTGGGGAGGG + Exonic
970843841 4:20511716-20511738 ATAAAAAAATGGGCCGGGCACGG - Intronic
972259253 4:37391911-37391933 ATTAAAACACGGGCTGGGCACGG + Intronic
972392469 4:38626678-38626700 ATAAAGAATTAGGCTGGGCACGG - Intergenic
972445109 4:39136448-39136470 ATTAAGGAAGGGGCTGGGTATGG - Intergenic
972657954 4:41084132-41084154 TTAAAGAAATAGGCTGGGCACGG + Intronic
972663828 4:41144826-41144848 TTAAAAGAACGGGCTGGGCATGG + Intronic
972908634 4:43785240-43785262 AAAAAAAAAAGGGTTGGGGAGGG - Intergenic
973282660 4:48376161-48376183 ATGAAGGAAGGGGCTGGGCACGG + Intronic
973799043 4:54458734-54458756 AAAAAGAAATAGGCTGGGCATGG - Intergenic
973937542 4:55863188-55863210 ATAAAAAAACAGGCTGGGCTTGG - Intronic
974034619 4:56807033-56807055 AAGAAGAAACAGGCTGGGCACGG + Intergenic
974436981 4:61869232-61869254 AAAAAAAAATGGGCTGGGCATGG - Intronic
975649560 4:76579176-76579198 ATAAATAAACAGGCTGGGCGTGG + Intronic
975883060 4:78933852-78933874 ATAAAGAATAGGCCTAGGGATGG + Intronic
976339027 4:83924766-83924788 TTACAAAAACGGGCTGGGCATGG + Intergenic
976412967 4:84738304-84738326 AAAAAGAGAGGGGCTGGGCATGG + Intronic
976441163 4:85076277-85076299 ATAACAAAACAGGCTGGGCATGG + Intergenic
977052197 4:92142591-92142613 ATAAAAAAAAAGGCTGAGGAAGG + Intergenic
977599774 4:98923599-98923621 AAAAAGAAAGGGGCTGGGCTTGG - Intronic
977601043 4:98933894-98933916 ATAAAAAAATGAGCTGGGCATGG - Intergenic
977612052 4:99046121-99046143 AGAAGGAAAGGGGCTGGGCATGG + Intronic
977705096 4:100061837-100061859 AGGAAGAAAAGGGCAGGGGAGGG - Intergenic
977878020 4:102171873-102171895 AAAAAGAAATGGGCCGGGCATGG + Intergenic
977940136 4:102848661-102848683 ATAAATAAATAGGCTGGGTATGG + Intronic
978251299 4:106634281-106634303 ATAAAACAATGGGCTGGGCACGG - Intergenic
978276199 4:106953464-106953486 ACAAAGATATGGGGTGGGGAGGG + Intronic
978826815 4:113034443-113034465 ATAAAGAAACCTCCTGGGGGTGG + Intronic
979234591 4:118385526-118385548 ATAAATAATTGGGCTGGGCATGG + Intergenic
979491470 4:121332869-121332891 ATAAAGAAAAGAGTTGGGGATGG - Exonic
979534933 4:121808828-121808850 ATAAAGAAATTAGCTGGGCATGG - Intronic
979536316 4:121824036-121824058 AGAAACAAACTGGCTGGGGCGGG + Intergenic
979613665 4:122717683-122717705 ATTAAGAAACTAGCTGGGCACGG - Intergenic
979672351 4:123373217-123373239 TTAAAGAAAAAGGCTGGGCATGG + Intergenic
979951809 4:126902166-126902188 ATACATAAATGGGCTGGGCACGG + Intergenic
981026015 4:140077727-140077749 ATAAAGAGAGGGGCCGGGTATGG + Intronic
981093813 4:140758564-140758586 AAAAATAAACAGGCTGGGCATGG + Intergenic
981394339 4:144229525-144229547 ATGAAGCAACAAGCTGGGGAGGG - Intergenic
981591995 4:146374431-146374453 ATACAGAAACTAGCTGGGCATGG + Intronic
981950337 4:150398916-150398938 ATATTGAAAAGGGCTGGGCATGG - Intronic
982223193 4:153141991-153142013 AGAAAGAAAGAGGCTGGGCATGG - Intergenic
982846443 4:160259066-160259088 ATAAATAAATTGGCTGGGCATGG - Intergenic
983140229 4:164141354-164141376 AAAAAGAAACTTGCTGGGGCTGG - Intronic
983589271 4:169389764-169389786 ATGAAGAAATGGGCTGGGCATGG - Intergenic
983677219 4:170309648-170309670 AGAGAGAAAGGGGCTGGGGGAGG - Intergenic
983854665 4:172628575-172628597 TTAAAGAAACGGCCAGGGCAAGG - Intronic
983871692 4:172831517-172831539 ATAAAGAAAGGTGGTGGAGATGG + Intronic
983979970 4:173983587-173983609 ATAAAGAAAGAGGCTGGGTGTGG + Intergenic
984742277 4:183176711-183176733 AAAAATAAAAGGGCTGGGCATGG - Intronic
985559897 5:579807-579829 ATCAAGAAGAGGGCTGTGGAGGG - Intergenic
985823644 5:2177886-2177908 ATAAAGGAACAGGCCGGGCATGG - Intergenic
986260943 5:6145747-6145769 ATAAATAAATTGGCTGGGCATGG - Intergenic
986543550 5:8871821-8871843 AGAAAGAAAGGGGGAGGGGAGGG + Intergenic
987045182 5:14101281-14101303 ATAATAAAACAGGCTGGGCATGG + Intergenic
988783402 5:34543842-34543864 ATAAATAAATGAGCTGGGAAGGG + Intergenic
989127830 5:38074181-38074203 TTAAAGAAGCTGGCTGGGCATGG - Intergenic
989196215 5:38719074-38719096 ATAAAGGGACGGGCTAGGGCCGG - Intergenic
989479973 5:41919440-41919462 ATAAACAAGGGGGCTGGGGCAGG - Exonic
989535916 5:42563322-42563344 AAAAAGAATCAGGCTGGGCACGG + Intronic
989800719 5:45535305-45535327 ATAGAGAAGCAGGCTGGGCATGG + Intronic
990220850 5:53586811-53586833 AGGAAGAAACAGGCTGGGCACGG - Intronic
990434471 5:55774305-55774327 ATAAAGAAATTAGCTGGGCATGG - Intronic
990446324 5:55897138-55897160 ATAAAGAAACAGGCTGGGCATGG - Intronic
990465163 5:56064977-56064999 ATACATAAATGGGCTGGGCACGG - Intergenic
991017322 5:61945967-61945989 AGGAAGAGAGGGGCTGGGGAGGG + Intergenic
991250335 5:64553460-64553482 AGAAAGGAAGGGGCTGGGCATGG - Intronic
991341457 5:65615190-65615212 ATAGAGAAATAGGCTGGGCACGG - Intronic
991492921 5:67200814-67200836 AAAAATAAACAGGCTGGGCATGG - Intergenic
991733364 5:69610022-69610044 AAAAAGGAAAGGGCTGGGCATGG + Intergenic
991809799 5:70465168-70465190 AAAAAGGAAAGGGCTGGGCATGG + Intergenic
991861590 5:71017829-71017851 AAAAAGGAAAGGGCTGGGCATGG - Intronic
991902087 5:71470879-71470901 AAAAAAAAAAGGGCTGGGCACGG - Intronic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
993050259 5:82918394-82918416 ATCAAGAAGCGGGGTGGGGCAGG - Intergenic
993301666 5:86219395-86219417 AAAAAGTAACTGGCTGGGTACGG + Intergenic
993368864 5:87067217-87067239 ATAAAGATTGGGGCTGGGAAAGG - Intergenic
993846815 5:92954123-92954145 ATAAAGAAAGGGGCTCAAGATGG - Intergenic
994084087 5:95739705-95739727 ATAAAAAAACTGGCTGGGTGTGG - Intronic
994996354 5:107068208-107068230 AAACAGAAATGGGCAGGGGAGGG + Intergenic
995119061 5:108516613-108516635 AGAAAGAAAAGAGATGGGGATGG - Intergenic
995307815 5:110675198-110675220 ATAAAAAAACTAGCTGGGCATGG - Intronic
995622891 5:114047221-114047243 AAAAAAAAAAGGGCTGGGCACGG + Intergenic
996338441 5:122410530-122410552 ATAATAAAAGGGGCTGGGTATGG + Intronic
997322845 5:132993044-132993066 ATAAATAAATAGGCTGGGCACGG - Intergenic
997369809 5:133351761-133351783 ATAAAAAAACTAGCTGGGCAAGG - Intronic
997385978 5:133473070-133473092 CTAAAGAAACAGGGAGGGGAAGG - Intronic
997567253 5:134897851-134897873 ATACAAAAACTAGCTGGGGATGG + Intronic
997576131 5:134979010-134979032 ATAACAAAACTGGCTGGGCACGG - Intronic
997924042 5:138011573-138011595 ATAAAAAAACTAGCTGGGCATGG - Intronic
997952995 5:138256789-138256811 ATAAAGAAATTAGCTGGGCATGG + Intronic
997957390 5:138289907-138289929 AAAATGAAATGGGCTGGGCATGG + Intronic
997957801 5:138293800-138293822 ATACAGAAATTGGCTGGGCATGG - Intronic
997958813 5:138302767-138302789 ACAGAGAAAAGGGCTGGGTAGGG + Intronic
998233742 5:140379932-140379954 ATAAATAAATGGGCCGGGCACGG - Intergenic
998495840 5:142588530-142588552 AGAAAGAAAAGGGCAGGGTAGGG - Intergenic
999139963 5:149353900-149353922 ATAAAGAAACAGGCTCAGAAGGG - Exonic
999411738 5:151356181-151356203 ATACAAAAACTGGCTGGGCATGG + Intergenic
1000088790 5:157911960-157911982 ATAAAAACATGGGCTGGGCATGG + Intergenic
1000318452 5:160115399-160115421 ATACAAAAACAGGCTGGGCACGG + Intronic
1000321225 5:160136127-160136149 ATAAATAAATAGGCTGGGCACGG + Intergenic
1000325454 5:160168638-160168660 ATAAAGAAATCAGCTGGGCATGG - Intergenic
1000482933 5:161802419-161802441 AGAAATAAATGGGCTGGGCATGG + Intergenic
1000861989 5:166466966-166466988 ATAGAAAAGAGGGCTGGGGACGG - Intergenic
1000892378 5:166815240-166815262 ATAAAAAAGTGGGCTGGGCATGG - Intergenic
1000959763 5:167585967-167585989 ATAAAGAAATAAGCTGGGCATGG + Intronic
1001139280 5:169130135-169130157 ACTAAGAAACTGGCTGGGCACGG - Intronic
1001143285 5:169163030-169163052 ATTAAAAAAGGGGCTGGGCACGG + Intronic
1001506238 5:172283279-172283301 ATAATTAAACGGCCTGGAGAGGG + Intronic
1001608463 5:172981054-172981076 AGAAAGAAAGGGGCTGGGCATGG + Intergenic
1001995130 5:176151270-176151292 ATAAAGAAACAGGCCGGGCGCGG - Intergenic
1002008372 5:176254984-176255006 ATAAAGAACCTGGCTAGGCATGG + Intronic
1002122868 5:177019242-177019264 ATAAAGAAACAGACTAGGAAAGG - Intronic
1002148140 5:177202532-177202554 ATAAAAATACTGGCTGAGGATGG - Intronic
1002208784 5:177583145-177583167 AGAAAGAAAAGGGGAGGGGAGGG - Intergenic
1002218348 5:177657287-177657309 ATAAAGAACCTGGCTAGGCATGG - Intergenic
1002907891 6:1465666-1465688 ATAAATAAACAGGCTGGGCATGG + Intergenic
1003296112 6:4830397-4830419 ATATAGCAGGGGGCTGGGGAAGG - Intronic
1003388671 6:5692998-5693020 ACAAAACAACGGGATGGGGAAGG - Intronic
1004896378 6:20152028-20152050 AAGAAAAAATGGGCTGGGGATGG + Intronic
1004906443 6:20240815-20240837 ATTAAAAAAGGGGCTGGGCATGG + Intergenic
1004919349 6:20361537-20361559 AAAAAGATGCGGGCTGGGCATGG + Intergenic
1005046250 6:21645711-21645733 ATAAATAAATGGGCTGGGTGTGG + Intergenic
1005047641 6:21657313-21657335 ACAAAAAAACCGGCTGGGCATGG + Intergenic
1005596497 6:27383261-27383283 ACAAAGACAGGGGGTGGGGAAGG + Intronic
1006004477 6:30991444-30991466 AAAAAAAAAAGGGCTGGGCACGG + Intergenic
1006112510 6:31756927-31756949 AAAAAAAAAAGGGCTGGGCATGG - Intronic
1006486667 6:34348485-34348507 AAAAAGAAACAGGCTGGGAGCGG + Intronic
1006597551 6:35204351-35204373 AAAAAGAAGTGGGCTGGGCATGG - Intergenic
1006609395 6:35284689-35284711 ATAAATAAAAAGGCTGGGCACGG - Intronic
1006616362 6:35330325-35330347 ATAAAGAAAAGGGCTGGGCGCGG + Intergenic
1006629847 6:35423236-35423258 AAAAAGAAAAAGGCTGGGCATGG + Intronic
1006661423 6:35648791-35648813 ATACAAAAACTGGCTGGGCATGG + Intronic
1006875824 6:37295258-37295280 ATAAAAAAATTGGCTGGGTATGG - Intronic
1007013416 6:38439416-38439438 ACAAAAAAACAGGCTGGGCATGG - Intronic
1007457773 6:41993564-41993586 ATACAGAAATTAGCTGGGGATGG - Intronic
1007478039 6:42132223-42132245 ATAAAAAAAGGGGCTGGGTGCGG + Intronic
1007572706 6:42904687-42904709 ACAAACAAACAGGCTGGGCATGG + Intergenic
1007603580 6:43099777-43099799 TTAAAGAATCTGGCTGGGGGTGG + Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1007771673 6:44197240-44197262 ACAAACAAACAGGCTGGGCACGG + Intergenic
1007867005 6:44982503-44982525 ATAAAGAATCGGGCTGGGCATGG - Intronic
1008259616 6:49348722-49348744 ATAAATCAACGGGCTGGGCCTGG - Intergenic
1008414257 6:51221284-51221306 ATAAAAAAAAGGGCAGGGGCGGG + Intergenic
1008752046 6:54746705-54746727 TTAAAGAAACAGGCTGGGCTTGG - Intergenic
1009479476 6:64139032-64139054 ATAAAGAGTTGGCCTGGGGATGG + Intronic
1009803992 6:68578737-68578759 AGAAAGAAAAGGGGAGGGGAGGG + Intergenic
1010132632 6:72512615-72512637 ATAGAGAAACTGGCTGGGCGTGG + Intergenic
1010381670 6:75232517-75232539 ATCAAGAAATGGGCTGGGCACGG + Intergenic
1010427882 6:75747019-75747041 AAAAAGAAAAGGGCTGGGCGTGG + Intergenic
1011037445 6:82993100-82993122 AGAAAGAAACGGGGTCGGGGGGG + Intronic
1011441221 6:87389587-87389609 ATACAGAAACAGGCAGGGGCTGG + Intronic
1011457797 6:87570708-87570730 ATAAAAAATCTGGCTGGGCATGG - Intronic
1011645081 6:89450044-89450066 AGAAAGAATCAGGCTGGGCACGG + Intronic
1011688322 6:89842092-89842114 ACAAACAAACGGGCTGGGCATGG - Intronic
1012099448 6:95012292-95012314 ATACAGAAACAGGCTGGGTGTGG - Intergenic
1012168383 6:95988044-95988066 AGAAAGAAATAGGCTGGGCATGG + Intergenic
1012480438 6:99661215-99661237 ATAAAAACACAGGCTGGGCACGG - Intergenic
1013245683 6:108284892-108284914 AAAAAGAAACTGGCTGGGCACGG + Intergenic
1013483482 6:110572756-110572778 AGAAAAAAACTGGCTGGGGGTGG - Intergenic
1013577145 6:111494897-111494919 AAAAGGAAATGGGCTGGGAATGG - Intergenic
1013999460 6:116348135-116348157 GTCAAGAAACAGGCTGGGCACGG + Intronic
1014104117 6:117543846-117543868 ATAAGGAAACAGGCTTGGGGAGG - Intronic
1014241454 6:119022347-119022369 AAAGAAAAACGGGCTGGGCATGG - Intronic
1014846625 6:126285648-126285670 ATTAACAAACGTTCTGGGGAAGG - Intergenic
1015184777 6:130402929-130402951 ATAAAGAAAAGAGATGGAGATGG - Intronic
1015209587 6:130682190-130682212 ATGAAGAAAGGGCCAGGGGAGGG - Intergenic
1015213244 6:130721373-130721395 ACAAAGAAAAGGGCCGGGCATGG + Intergenic
1015560051 6:134504458-134504480 CTAAAGAAAAGGGCTGGGTGCGG + Intergenic
1015632034 6:135241507-135241529 CTAAAGAAATGAGCTGGGCATGG + Intergenic
1016475104 6:144418840-144418862 ATAAAACAACTGGCTGGGCACGG - Intronic
1016968048 6:149736971-149736993 AAAAAAAAACAGGCTGGGCACGG - Intronic
1017129363 6:151094697-151094719 ATAAAAAAACTAGCTGGGCATGG - Intronic
1017141051 6:151190374-151190396 ATTAAAAAAAGGGCTGGGCATGG + Intergenic
1017167106 6:151419058-151419080 AAAAAGAAAAAGGCTGGGCACGG - Intronic
1017311116 6:152978833-152978855 AAAAAGAAACTAGCTGGGCATGG + Intronic
1017365548 6:153632537-153632559 ATAAAAAAATGAGCTGGGCACGG - Intergenic
1017705115 6:157115100-157115122 AAAAAGAGATGGGGTGGGGACGG - Intronic
1017892665 6:158652216-158652238 ATAAATAAACAGGCTGGGCTCGG - Intronic
1018016974 6:159721355-159721377 ATAAATAAAACGGCTGGGCACGG - Intronic
1018667399 6:166151130-166151152 ACAAACAAACAGGCTGGGCATGG - Intergenic
1019679262 7:2336109-2336131 AAAAAAAAAAGGGCTGGGCACGG + Intronic
1019681538 7:2353131-2353153 ATAAAGAAATTAGCTGGGCACGG + Intronic
1020008661 7:4796192-4796214 GTAAAGAAACAGGCCGGGCACGG - Intergenic
1020386940 7:7616918-7616940 ATAAAGAAAGGAGCTGGATATGG + Intergenic
1020954301 7:14720631-14720653 AAAAAGAAAGGGGCCGGGCATGG - Intronic
1021107424 7:16653954-16653976 ATATAGAGACTGGCTGGGCATGG + Intronic
1021220115 7:17965788-17965810 AAAAATAAAGGGGCTGGGAAAGG + Intergenic
1021737158 7:23651037-23651059 ATAAAGAAAGTGGCTGGGTGTGG + Intergenic
1022530915 7:31066325-31066347 ATAAAGGTAGGGGCTGGGGTGGG + Intronic
1022773213 7:33496828-33496850 AAAAAGAAACGGCATGGAGATGG - Intronic
1023105004 7:36755525-36755547 ATACAGAAATGAGCTGGGCATGG - Intergenic
1023178875 7:37460935-37460957 ATACAGAAACTGGCTGGACATGG - Intergenic
1024373061 7:48608169-48608191 AAAAACAAACTGGCTGGGCATGG - Intronic
1025002018 7:55324096-55324118 AAAAAGAAACTGGCTGGGTGCGG - Intergenic
1025040141 7:55635142-55635164 AAAAAGAAATGGGCTGGGCGTGG - Intergenic
1025625907 7:63221481-63221503 TTACAGAAACAGGCTGGGGGCGG + Intergenic
1025656208 7:63521654-63521676 TTACAGAAACAGGCTGGGGGCGG - Intergenic
1025805637 7:64830611-64830633 ATGAAGATACAGGCTGGGCATGG - Intronic
1025923006 7:65931929-65931951 ATCAATAAATGGGCTGGGCATGG - Intronic
1025985326 7:66445754-66445776 ATAAATAATCTGGCTGGGCATGG + Intergenic
1026490115 7:70856000-70856022 ACAAAGAAACTGGCCGGGCACGG - Intergenic
1026526902 7:71161941-71161963 AAAAAGAAAAGGGGAGGGGAGGG - Intronic
1026566656 7:71495118-71495140 ATACAGAAACTAGCTGGGCATGG + Intronic
1026778751 7:73249297-73249319 ATAAATAAATAGGCTGGGCATGG - Intergenic
1026788293 7:73315643-73315665 ATAAAAGAAGGGGCTGGGCACGG - Intronic
1026946443 7:74319220-74319242 AGAAAGAAAAAGGCCGGGGACGG + Intronic
1027205238 7:76092533-76092555 AAAGAGAAAAGGGCTGGGCATGG + Intergenic
1027516154 7:79144849-79144871 ATAAATAGAGGGGTTGGGGAAGG - Intronic
1027665580 7:81040081-81040103 ATACAAAAATTGGCTGGGGATGG - Intergenic
1028811631 7:95094587-95094609 AGATAGAAACAGGCTGGGCATGG + Intronic
1029460549 7:100691749-100691771 AGAAAGAGAAGGGGTGGGGAAGG - Intergenic
1029731435 7:102440840-102440862 ATAAGGAAACAGGCTGGACAAGG - Intronic
1029858337 7:103541444-103541466 ATAAATGAATGGGGTGGGGAAGG - Intronic
1029968259 7:104763238-104763260 ATAAAGACAAGGTCTGGCGAAGG - Intronic
1030164747 7:106542854-106542876 ATAAAGAAAAATGCTGGGGTTGG + Intergenic
1030352682 7:108507362-108507384 AAAAAGAAACAGGCTGGGTGAGG + Intronic
1031383565 7:121118270-121118292 AAAAAGAAACCGGCTGGGCGCGG + Intronic
1031420782 7:121549439-121549461 ATACAAAAACTGGCTGGGCATGG + Intergenic
1031900157 7:127400033-127400055 AAAAATAAACTGGGTGGGGAGGG + Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1031965723 7:128026973-128026995 ATAAAAAAGCGGGGAGGGGAGGG - Intronic
1032130028 7:129220350-129220372 ACAAAAAAACAGGCTGGGCACGG + Intergenic
1032147600 7:129398299-129398321 AAAAAGAAATGGGCTGGGCATGG - Intronic
1032215807 7:129956265-129956287 AAAAAGAATCCGGCTGGGTATGG + Intergenic
1032363942 7:131282057-131282079 ATAAAAAGATGGGCTGGGCATGG + Intronic
1033011943 7:137632566-137632588 ATAAAGATACAGGCCGGGCATGG + Intronic
1033310856 7:140260778-140260800 GTAAAGAAAAGGGCGGGGGGGGG - Intergenic
1033330393 7:140412514-140412536 AAAAAAAAATGGGCTGGGCATGG - Intronic
1033332633 7:140429018-140429040 AAAAAAAAAAGGGCTGGGCACGG - Intergenic
1033345964 7:140525953-140525975 ATGAAGAGCAGGGCTGGGGAGGG + Intronic
1033360628 7:140636673-140636695 AAAAAAAAAAAGGCTGGGGAGGG - Intronic
1033522458 7:142175007-142175029 ATAAATAAACGGGCTAGGCACGG - Intronic
1034164182 7:149013090-149013112 ATACAGAAACTAGCTGGGCATGG + Intronic
1034173181 7:149079116-149079138 AGAATGAAACGGGCTGGGCGTGG + Intronic
1034191446 7:149216388-149216410 ATAAAATAACGGGCTGGGCCTGG - Intronic
1034429838 7:151035771-151035793 AAAGAGAAACGGTGTGGGGAGGG - Intronic
1034684468 7:152958130-152958152 AAAAAGAAAGGGGCTGGGAGGGG - Intergenic
1035420786 7:158727774-158727796 ATAAAAAAACTAGCTGGGCATGG - Intergenic
1035539181 8:418628-418650 ATAAAGAAACAAGCCGGGAACGG - Intronic
1035547432 8:494249-494271 AAACAGAAATGGGCTGGGCATGG - Intronic
1035620539 8:1033510-1033532 ATACAGAAACTAGCTGGGCATGG + Intergenic
1036493848 8:9251798-9251820 ATATAAAAACAGGCTGGGGCTGG + Intergenic
1037548710 8:19948937-19948959 AAAAAAAAAAGGGCTGGGCAGGG + Intronic
1037583608 8:20261540-20261562 ATGCAGAAGGGGGCTGGGGATGG - Intronic
1037778689 8:21852634-21852656 ATAAATAAATAGGCTGGGCATGG + Intergenic
1037781901 8:21875226-21875248 ATAAAAAAATTGGCTGGGCATGG - Intergenic
1038018520 8:23534241-23534263 AAAAAGAAAGAGGCTGGGCATGG - Intronic
1038978280 8:32725762-32725784 ATCAGGAAATGGGCTGGGTACGG - Intronic
1039037757 8:33378221-33378243 ATGAGGAAAAGGTCTGGGGAGGG - Intronic
1039558075 8:38491089-38491111 ATGAAGAAACTGGCTGGGTGTGG - Intergenic
1040026112 8:42784390-42784412 ATAAAGAATCTGGCTGGTCATGG + Intronic
1040029287 8:42809789-42809811 ATAAACAAATTGGCTGGGCATGG - Intergenic
1040469018 8:47720911-47720933 ATAAAAAAACTAGCTGGGCATGG - Intronic
1040690214 8:49928384-49928406 ATAAAAAAATTGGCTGGGCACGG - Intronic
1041093301 8:54325047-54325069 TTAAAAAAAAGGGCTGGGGCTGG + Intergenic
1041237038 8:55814101-55814123 ATAAAAAAACTAGCTGGGCATGG - Intronic
1041921957 8:63192318-63192340 TGAAAGAAACGGGGTGGGGAGGG - Intronic
1042282807 8:67072709-67072731 ATGAAAAAACTAGCTGGGGATGG + Intronic
1042838013 8:73094894-73094916 ATAAGGAAAAGGGCTGGTGGGGG - Intronic
1043006169 8:74821363-74821385 AAAAAAAAATGGGCTGGGCACGG - Intronic
1043017652 8:74960642-74960664 ATAAATAAATGGGGTGGGGAGGG - Intergenic
1043662138 8:82757051-82757073 AGAAAGAAAGGGGGTGGGGAGGG + Intergenic
1043861198 8:85319172-85319194 ATAATAATACGGGCTGGGCACGG - Intergenic
1044288859 8:90444088-90444110 AAAACGAAAGGGGCTGGGCACGG + Intergenic
1044365656 8:91342218-91342240 ATAAAGAAGCTGGCTGAGCACGG - Intronic
1044654519 8:94533729-94533751 ATAAATAAATAGGCTGGGCATGG - Intronic
1044970506 8:97615111-97615133 ATAAATAAATAGGCTGGGCACGG + Intergenic
1044989475 8:97782724-97782746 AAAAAAAAAAAGGCTGGGGACGG - Intronic
1045281132 8:100750580-100750602 AGAAAGGAATAGGCTGGGGATGG + Intergenic
1045289529 8:100820723-100820745 TTAAAAAAACTGGCTGGGCAAGG - Intergenic
1046517744 8:115285303-115285325 TGAATGAAATGGGCTGGGGAGGG + Intergenic
1046922951 8:119753212-119753234 AAAAATAAACTGGCTGGGCATGG - Intronic
1047231265 8:123000277-123000299 AGAAAGAAAAGGGAAGGGGAGGG + Intergenic
1047408359 8:124603963-124603985 AAAAACAAACAGGCTGGGCATGG + Intronic
1047608368 8:126496809-126496831 ATAAAGAAATGAGCTGGGCATGG - Intergenic
1047691374 8:127358108-127358130 ATAAAGCAAGGGCATGGGGATGG + Intergenic
1048003299 8:130397429-130397451 ATAAATATACGGGCTGGGCATGG - Intronic
1048077764 8:131091780-131091802 ATAAATATACTGGCTGGGCATGG - Intergenic
1048865942 8:138761910-138761932 ATAAAGAAAAGTGTTGGGAATGG - Intronic
1049084549 8:140468497-140468519 AGAAGGAAAGGGGCTGGGCATGG - Intergenic
1050693630 9:8256255-8256277 AAAAAAAAAAGGGCTGAGGAGGG - Intergenic
1051077145 9:13252578-13252600 AAAAAAAATCGGGCTGGGCATGG + Intronic
1051585204 9:18720286-18720308 ATAAGAAAACAGGCTGGGAAGGG - Intronic
1051642779 9:19238648-19238670 AAAAAAAAAGGGGCAGGGGAAGG - Intronic
1052188166 9:25624092-25624114 ACAAAAAAACAGGCTGGGCACGG - Intergenic
1052305025 9:26998691-26998713 ATTAATAAATGGGCTGGGCATGG + Intronic
1052955768 9:34252135-34252157 CAAAAGAAACAGGCTGGGGTAGG - Exonic
1052976097 9:34411397-34411419 AAAAAAAAAAGGGCTGGGCACGG + Intronic
1052976837 9:34417335-34417357 ATAAAGCTAGGGGCTGGGAATGG - Intronic
1053223763 9:36333606-36333628 AAAAAAAAAAGGGCTGGGCATGG - Intergenic
1053429231 9:38031029-38031051 ATGAAGGAAAGGGCTGGGCATGG + Intronic
1055171195 9:73260158-73260180 ATAATAAAACGGGCTGGGTATGG + Intergenic
1055873276 9:80911722-80911744 ATAAGGAAAAGGGCTCGGGGAGG - Intergenic
1055903083 9:81263293-81263315 AAAAAGAAATGGGCGAGGGAGGG + Intergenic
1056011177 9:82332240-82332262 TTAAAGAGAATGGCTGGGGATGG - Intergenic
1056221674 9:84456017-84456039 TTAAAGAGGTGGGCTGGGGAAGG + Intergenic
1056282766 9:85058125-85058147 AAAAAGAAAGGGGCAGGGGAAGG + Intergenic
1057414169 9:94846613-94846635 AGAAAGAAGCTGGCTGGGCATGG + Intronic
1057675006 9:97131280-97131302 AGAAAGAAAGGGGAGGGGGAGGG + Intergenic
1057932775 9:99210684-99210706 AGAAAGAAAGGGGAAGGGGAAGG - Intergenic
1058312085 9:103515752-103515774 ATAAAAAAATGAGCTGGGCATGG + Intergenic
1058513021 9:105740036-105740058 ATACAGAAACTAGCTGGGCATGG - Intronic
1058992182 9:110265155-110265177 AAAAAAAAAAGGGCTGGGCAAGG + Intergenic
1059081263 9:111252891-111252913 AGAAAGAAATGGGTTGGGGAAGG - Intergenic
1059502508 9:114767006-114767028 ATAAGGAAACAGGCTGGGCATGG - Intergenic
1059869343 9:118554269-118554291 ATAAATAACTGGTCTGGGGATGG - Intergenic
1060392418 9:123289132-123289154 AAAAAAAAATGGGCTGGGCACGG - Intergenic
1060403770 9:123362835-123362857 AAGAAGAAACTGGCTGGGCAGGG - Intronic
1060492541 9:124095476-124095498 AAAAAAAAACCGGCTGGGCACGG - Intergenic
1060563461 9:124567883-124567905 AAAGAGAAACAGGCTGGGCACGG + Intronic
1060584006 9:124774649-124774671 ATCAAGAAAGGGCTTGGGGAGGG + Intergenic
1060601580 9:124881696-124881718 AGAGAGAAAGGGGCTGGGCAGGG + Intronic
1060619275 9:125048567-125048589 AAGAAGAAAAGGGCAGGGGAGGG + Intronic
1060838021 9:126772490-126772512 ATAAATAAATAGGCTGGGCACGG + Intergenic
1060844628 9:126826300-126826322 ATATAAAAATGGGCTGGGCATGG - Intronic
1061106282 9:128533131-128533153 ATGATGAAACAGGCTGGGCATGG + Intronic
1061146837 9:128804697-128804719 AGAAAAAAAAGGGCTGGGCACGG - Intronic
1061588112 9:131581396-131581418 ACAAAGAAACTGGCTGGGTGTGG + Intronic
1062356223 9:136164595-136164617 AAAAAAAAATGGGCTGGGCACGG + Intergenic
1062507087 9:136883158-136883180 AAAAAAAAACTGGCTGGGCATGG - Intronic
1062588256 9:137260741-137260763 AAAGAGAATCGGGCTGGGCACGG - Intronic
1203515887 Un_GL000213v1:1069-1091 ATAAAGAAAGGGTCTAGTGAGGG + Intergenic
1185512535 X:674154-674176 ATAAAGGAGCCAGCTGGGGAAGG + Intergenic
1185604595 X:1360816-1360838 ATAAAGAGAGGGGCCGGGCACGG - Intronic
1185611902 X:1398023-1398045 ATAAAAAGACGGGCTGGGCGTGG + Intergenic
1185881242 X:3743158-3743180 ATACAAAAACGAGCTGGGCATGG + Intergenic
1186438777 X:9567050-9567072 ATGATAGAACGGGCTGGGGAAGG + Intronic
1187214010 X:17257293-17257315 AAAAAAAAACTGGCTGGGCATGG + Intergenic
1187460313 X:19480822-19480844 AAAAAAAAAAGGGCTGGGTATGG + Intronic
1188181382 X:27060064-27060086 ATAGAAAAACCGGCTGGGCATGG - Intergenic
1188470945 X:30538644-30538666 ATAAAGACACAGGCCGGGCATGG + Intergenic
1188517191 X:31000148-31000170 ATAAAGAATCTGGCTGGGTACGG - Intergenic
1188565435 X:31521316-31521338 ATAAAAAAACTGGCCGGGCATGG - Intronic
1188987908 X:36784509-36784531 ACAAAGGTACGGGCTGGGCACGG + Intergenic
1189259238 X:39666395-39666417 ACAAGGAAACAGGCTGGGGCAGG + Intergenic
1189479223 X:41380411-41380433 ACAAAAAAACTGGCTGGGCAAGG - Intergenic
1189660418 X:43291096-43291118 AGAAGAAAACGGGCTGGGCATGG - Intergenic
1190085723 X:47393731-47393753 AAAAAAAAAAGGGCGGGGGAGGG - Intronic
1190087638 X:47409631-47409653 AAAAAGAAGCTGGCTGGGCATGG - Intronic
1190329235 X:49225691-49225713 ATAAAGAAAGGTGCTGAGAAAGG + Intronic
1190791388 X:53703760-53703782 ATACAGAAACTGGCCGGGCATGG - Intergenic
1190804533 X:53822452-53822474 AAAAAGAAATGGGCTGGGCGTGG + Intergenic
1191765051 X:64689204-64689226 ATAAAGAATCAGGCTCAGGAGGG + Intergenic
1192268241 X:69555324-69555346 ATAGAGAATGTGGCTGGGGATGG + Intergenic
1192561849 X:72132430-72132452 CTGAAAAAAGGGGCTGGGGATGG - Intergenic
1193344948 X:80394682-80394704 ATAAATAAGCAGGCTGGGCATGG - Intronic
1193384455 X:80854285-80854307 ATGAAGAAAGAGGCTGGGCATGG - Intergenic
1194720932 X:97339357-97339379 ATAAAGAAATTAGCTGGGCATGG + Intronic
1194735365 X:97506439-97506461 AAAAAAAAAAGGGCTGGGCATGG - Intronic
1195068752 X:101260184-101260206 ATGGAGAAAGGGGCTGGGAAAGG - Intronic
1195100743 X:101552001-101552023 ATAATGACACGGGGTGGGGGGGG + Intronic
1195241594 X:102958489-102958511 ACAAAGAACCAGGCTGGGCATGG - Intergenic
1195386034 X:104314250-104314272 AGAAAGAAACAGGCAGGGCAAGG - Intergenic
1195392237 X:104374831-104374853 AAAAAGAACCAGGCTGGGTATGG + Intergenic
1195675226 X:107502713-107502735 ATAGAGAAATGGCCTGGGAATGG + Intergenic
1195885935 X:109637383-109637405 ACAAAAAAAGGGGCTGGGCATGG - Intronic
1195950462 X:110266669-110266691 AAAAAGAGACAGGCTGGGCACGG - Intronic
1196283749 X:113855673-113855695 ATACAGAACCAGGCTGGGCATGG + Intergenic
1196295512 X:113992538-113992560 AAAAATAAACGGGGGGGGGAGGG - Intergenic
1196786321 X:119424454-119424476 ATAAAAAAAGGGCCTGAGGAAGG - Intronic
1196788969 X:119447242-119447264 AGAGAGAATCGGGCTGGGCATGG - Intronic
1196909765 X:120473646-120473668 TTAAATAAATGGGCTGGGCACGG + Intergenic
1196933632 X:120707027-120707049 CTAAAGAAACAGGCCGGGCACGG + Intergenic
1197254288 X:124246348-124246370 AAAAAGGAATGGGCTGGGCACGG - Intronic
1197298080 X:124743990-124744012 AGGAAGAAATGGGCTGGGGGAGG - Intronic
1197480875 X:126984425-126984447 ATGAAGAGACGGGGTGGGGGAGG - Intergenic
1197500403 X:127233855-127233877 ATAAAAAAATTAGCTGGGGATGG + Intergenic
1197878675 X:131140650-131140672 ATAAAGAAACGGCATTGTGATGG - Intergenic
1197948707 X:131871256-131871278 AGAAAGAAACAGGCTGGGCGCGG + Intergenic
1198032964 X:132772098-132772120 ATAAAGAAATGGCCTGGTCATGG + Intronic
1198114305 X:133530325-133530347 ATAAAGCATAGGGCTGGGCATGG - Intergenic
1198156939 X:133970200-133970222 GTTAAGCAAAGGGCTGGGGAGGG + Intronic
1199182511 X:144875170-144875192 AAAAAAAAACAGGCTGGGCACGG - Intergenic
1199381196 X:147174417-147174439 ATAAATAAATAGGCTGGGCATGG - Intergenic
1199644570 X:149893850-149893872 ATATAGAAACTGGCCGGGCATGG + Intergenic
1199728607 X:150608507-150608529 ATAAATTAAAGGGCTGGGCATGG - Intronic
1199839086 X:151625651-151625673 AGAAACAAACGGGCCAGGGATGG + Intronic
1200054691 X:153453973-153453995 ATACAGAAACTAGCTGGGCATGG - Intronic
1201395882 Y:13548311-13548333 AAAAAGAAAAGGGCGGGGGGTGG - Intergenic
1201760144 Y:17528184-17528206 ATAAAGAAAATAGCTGGGCATGG - Intergenic
1201841410 Y:18377806-18377828 ATAAAGAAAATAGCTGGGCATGG + Intergenic
1202240275 Y:22759963-22759985 ATAAATAAATGGGCTGGGCGTGG + Intergenic
1202393261 Y:24393717-24393739 ATAAATAAATGGGCTGGGCGTGG + Intergenic
1202477524 Y:25276383-25276405 ATAAATAAATGGGCTGGGCGTGG - Intergenic
1202572121 Y:26283282-26283304 AAAAAAAAACAGGCTGGGCATGG + Intergenic