ID: 1130984492

View in Genome Browser
Species Human (GRCh38)
Location 15:88836185-88836207
Sequence TAGTTCACCTGGAAGAGGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130984492_1130984497 -6 Left 1130984492 15:88836185-88836207 CCTCCCCTCTTCCAGGTGAACTA 0: 1
1: 0
2: 0
3: 21
4: 190
Right 1130984497 15:88836202-88836224 GAACTATGACCACTTTACTCTGG 0: 1
1: 0
2: 0
3: 1
4: 68
1130984492_1130984498 -5 Left 1130984492 15:88836185-88836207 CCTCCCCTCTTCCAGGTGAACTA 0: 1
1: 0
2: 0
3: 21
4: 190
Right 1130984498 15:88836203-88836225 AACTATGACCACTTTACTCTGGG 0: 1
1: 0
2: 0
3: 6
4: 107
1130984492_1130984501 13 Left 1130984492 15:88836185-88836207 CCTCCCCTCTTCCAGGTGAACTA 0: 1
1: 0
2: 0
3: 21
4: 190
Right 1130984501 15:88836221-88836243 CTGGGTTTTCGTGACTCTGAGGG 0: 1
1: 0
2: 2
3: 16
4: 148
1130984492_1130984500 12 Left 1130984492 15:88836185-88836207 CCTCCCCTCTTCCAGGTGAACTA 0: 1
1: 0
2: 0
3: 21
4: 190
Right 1130984500 15:88836220-88836242 TCTGGGTTTTCGTGACTCTGAGG 0: 1
1: 0
2: 0
3: 18
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130984492 Original CRISPR TAGTTCACCTGGAAGAGGGG AGG (reversed) Exonic
901556774 1:10037938-10037960 TAGTTCATCTGCAAGATGGTTGG + Intronic
901841225 1:11955204-11955226 TCCTTCACCTGGAAGGTGGGAGG - Intronic
902223008 1:14978722-14978744 TTGCTCTCCTGGAAGATGGGGGG + Intronic
904448519 1:30595787-30595809 GAGGTCACCTGGAGGAAGGGAGG - Intergenic
907758130 1:57330898-57330920 CAGTTCACCAGGAAGAGGAGAGG - Intronic
909017600 1:70396594-70396616 TAGTTCATCTGGAAAGGGGAAGG + Intergenic
910325305 1:85999820-85999842 TGGTTCACCTGGGAGATGAGAGG + Intronic
914259246 1:145985117-145985139 TAGGTCACCTGGAAGGTGGAAGG - Intergenic
915357196 1:155262403-155262425 GAAGTCACATGGAAGAGGGGCGG - Intronic
916090523 1:161305291-161305313 TGGGCCACCTGGTAGAGGGGAGG + Exonic
917952248 1:180051265-180051287 CAGTTCATCTGGTAGAGCGGAGG - Intronic
919326169 1:196109701-196109723 TAGTTCTCCTTGAAGAGGTGTGG - Intergenic
919540274 1:198836945-198836967 ATGTTCTCCTGGAAGAGGTGGGG - Intergenic
919794364 1:201312230-201312252 TTCTTGCCCTGGAAGAGGGGAGG + Intronic
919887084 1:201942428-201942450 GAGTTGACCTGGAAGAGGCAAGG + Intronic
919979875 1:202636207-202636229 TATTTCACCTGGAAAAAGGATGG - Intronic
920560448 1:206934739-206934761 TGGTTCTCCTGGAGGAGGGAGGG + Exonic
923495251 1:234519140-234519162 TAGTTCAGCTGGGAGGGGGCTGG - Intergenic
923853060 1:237818030-237818052 TAGTTCACTTGGAGGAGGTATGG + Intronic
1063862353 10:10324860-10324882 TAGGACAACTGGAAGTGGGGAGG + Intergenic
1065020169 10:21496412-21496434 GAGGTCCCCGGGAAGAGGGGAGG + Intronic
1065541979 10:26779613-26779635 TAGTTTGCTTGGAAGAGGAGGGG + Intronic
1066003577 10:31127335-31127357 AAGGTCACCAGGAAGAGGGAAGG - Intergenic
1071342122 10:84658897-84658919 AAGGGCACCTGGAAGTGGGGAGG + Intergenic
1072129781 10:92483122-92483144 TATTTCACCTAGAAAAGGAGAGG - Intronic
1072294558 10:93996424-93996446 TGGTGCTTCTGGAAGAGGGGTGG + Intronic
1073804182 10:107078722-107078744 TAGTTTTCTTGGAAGAGGAGAGG - Intronic
1074216572 10:111390594-111390616 TAGATCAGCGGGGAGAGGGGAGG - Intergenic
1074579890 10:114708931-114708953 ATGCTGACCTGGAAGAGGGGAGG - Intergenic
1075022763 10:118963659-118963681 TATTTCACCTGGGTGCGGGGGGG + Intergenic
1076216462 10:128697685-128697707 GAGTTCACCAGGCAGATGGGAGG - Intergenic
1077486289 11:2839800-2839822 GAGGTCACCTGGGAGAGGTGTGG + Intronic
1080240844 11:30125596-30125618 TATTTCTCATGGAGGAGGGGAGG - Intergenic
1083001158 11:59292198-59292220 TAGTTTTCCAGGAAGAGGGTGGG + Intergenic
1083411232 11:62493794-62493816 TAGTTCACCTGTAAGAAGGAAGG - Intronic
1084785309 11:71438566-71438588 GAGTTAACCTGGTAGAGTGGAGG - Intronic
1086865140 11:91971424-91971446 TAGTACATCTGGGAGAGGTGGGG - Intergenic
1087885165 11:103472111-103472133 TAGTTCATATGGAAGAATGGTGG + Intronic
1089302764 11:117508482-117508504 AAGTTCACCTGCGAGAGGGCAGG + Intronic
1089348858 11:117809788-117809810 TAGTTGAGCTGGAACTGGGGAGG - Intronic
1091061967 11:132472029-132472051 TTGTTCACCAGGAAAAGGGAGGG - Intronic
1093193281 12:16100128-16100150 TAGTTCAAGTGGAGGAGGGGAGG + Intergenic
1094559291 12:31535363-31535385 TAATTCACCTGGAGGTGGGGTGG - Intronic
1096412827 12:51389769-51389791 AAGTTCAGCTGGAAGAAGTGGGG - Intronic
1097026881 12:56063300-56063322 TTTTTCACCTGGAACAGGGAAGG - Intergenic
1097985973 12:65783488-65783510 TATTTCATCTGGGGGAGGGGAGG + Intergenic
1098220393 12:68264300-68264322 TATTTCAACTGGAATAGGGCAGG - Intergenic
1101990141 12:109477514-109477536 TATTTCAGCTGCCAGAGGGGAGG + Exonic
1103553400 12:121751598-121751620 TAGAGCACCTGGGAGAGGGTTGG + Intronic
1104555664 12:129797732-129797754 TGGATAACCTGGAAGAGGGCAGG + Intronic
1105891325 13:24684579-24684601 TTTTTCCCCTGGGAGAGGGGTGG - Intronic
1106694317 13:32155122-32155144 TACGTCTCCTGGAAGAAGGGAGG - Intronic
1110674066 13:78218703-78218725 TAGGTAGCCAGGAAGAGGGGCGG - Intergenic
1112605650 13:100903433-100903455 TAGATCACTTGGAAGAGATGGGG - Intergenic
1112744745 13:102514119-102514141 TTGATCACCTGGCAGAGGGAGGG - Intergenic
1113109733 13:106810234-106810256 GAGTTAATCTGGAAGAGGGTAGG - Intergenic
1113770518 13:112905323-112905345 TACTTCAAATGGAACAGGGGTGG + Intronic
1114212821 14:20630482-20630504 TAGCTCACCTGGTAGAGCGGAGG - Intergenic
1114215208 14:20653163-20653185 TAGCTCAGCTGGTAGAGCGGAGG - Intergenic
1114215875 14:20657528-20657550 TAGCTCAGCTGGTAGAGCGGAGG - Intergenic
1114216274 14:20660022-20660044 TAGCTCAGCTGGTAGAGCGGAGG - Intergenic
1114216786 14:20663256-20663278 TAGCTCAGCTGGTAGAGCGGAGG - Intergenic
1114219399 14:20683280-20683302 TAGCTCAGCTGGTAGAGCGGAGG + Intergenic
1114350567 14:21846167-21846189 TCGTTCATCAAGAAGAGGGGTGG - Intergenic
1114624606 14:24120702-24120724 GAGTTCACCTGGATGAAGAGAGG + Intronic
1118684381 14:68276805-68276827 TAGTTCATCAGAAAGAGGGTAGG + Intronic
1118900208 14:69980049-69980071 TGGTCCAGCTGGAAGTGGGGGGG + Intronic
1119772333 14:77227996-77228018 TAGTTTACAGGGAAGAGGTGTGG + Intronic
1120695403 14:87639042-87639064 TTCTTCACCTGTAAGATGGGGGG - Intergenic
1121792790 14:96711673-96711695 GAGAGCACCTGGCAGAGGGGAGG + Intergenic
1122517587 14:102319689-102319711 TACGTCACCTAGGAGAGGGGCGG - Intronic
1124495492 15:30184244-30184266 TATTTCACCTGGAAAAAGGATGG - Intergenic
1124748081 15:32354402-32354424 TATTTCACCTGGAAAAAGGATGG + Intergenic
1125084702 15:35716351-35716373 TAGTTCTCCTTGAAGAGGTTGGG + Intergenic
1127551287 15:60041149-60041171 TAGTTCAGCTGGGAGAGCAGAGG - Intronic
1128360365 15:66957450-66957472 TATTTCACCTGGAGTAGGGAGGG + Intergenic
1128766037 15:70251764-70251786 GAGCTCACCTGGAAGAGGGTGGG + Intergenic
1129359437 15:75015425-75015447 TAGTTCAGCTAGATGAGGTGGGG + Intronic
1129655831 15:77525324-77525346 CAGTTCTCCTGGAAGGAGGGAGG + Intergenic
1130984492 15:88836185-88836207 TAGTTCACCTGGAAGAGGGGAGG - Exonic
1131119453 15:89813762-89813784 TAATTCACCTGTGAAAGGGGAGG - Intronic
1133000147 16:2846411-2846433 TAGGACAACTGGAAGGGGGGGGG - Intergenic
1137031982 16:35532425-35532447 TAGTTCAGCTGTGAGGGGGGCGG - Intergenic
1137850444 16:51736709-51736731 TAGTTCACTTGGAAGTGGGCGGG + Intergenic
1143622973 17:8091526-8091548 TGGTTCTCCTGGACCAGGGGCGG + Intergenic
1143720755 17:8807470-8807492 TAGCTCACCTAGGTGAGGGGAGG + Intronic
1147215805 17:38898397-38898419 TAGCGCACCTGCAGGAGGGGAGG - Exonic
1147913921 17:43875599-43875621 TGGCTCACCTGGAACAGGGCTGG - Intronic
1148783545 17:50134567-50134589 TTTGGCACCTGGAAGAGGGGAGG + Exonic
1149376269 17:56047334-56047356 TAGTTCATCTCCAAGAGAGGGGG + Intergenic
1149431168 17:56596296-56596318 TAGGTCCCCGGGGAGAGGGGAGG - Intergenic
1153014127 18:568061-568083 AAGTTCACCTGGAAAATGGGTGG + Intergenic
1155560092 18:27066257-27066279 TACTACACCTGGAAGAGAGAGGG - Intronic
1155767161 18:29650067-29650089 TAGATTACCTGCATGAGGGGAGG + Intergenic
1159928592 18:74291035-74291057 GCGTTCACCTGGAAGAGGCTCGG - Intronic
1160294152 18:77622494-77622516 GAGTACACCTAGAAGAGGGGAGG + Intergenic
1160893366 19:1391104-1391126 TCGTAGACCTGGAAGAGAGGCGG - Exonic
1161010373 19:1956966-1956988 TGGCTCACCTGGAAGAGAGAAGG + Intronic
1161591964 19:5133001-5133023 TGGTTCACCTAGAGGAGGGCAGG - Intronic
1162770861 19:12948641-12948663 TAGGTCACCAGGAAGAGGAAAGG - Intronic
1163039365 19:14591096-14591118 GAGCTCAACTGGGAGAGGGGAGG + Intronic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1165927609 19:39336643-39336665 AAGGCCACCTGGAGGAGGGGAGG - Intronic
925308720 2:2866935-2866957 TAATTCACCTGGAAGTTTGGTGG + Intergenic
926140226 2:10364024-10364046 CAGGCCACCTGGAGGAGGGGTGG + Intronic
926728389 2:16015573-16015595 TGTTTCACCTGGAAGGGGGATGG - Intergenic
926991888 2:18689081-18689103 TATTTCACCTGAAAAAAGGGAGG + Intergenic
927655687 2:24943496-24943518 TAGCTCCCCTGAAAGAGGGGTGG + Intergenic
927872650 2:26633470-26633492 TCTCTCACCTGGAAGAAGGGTGG - Intronic
936559174 2:113521676-113521698 GAGTTGACCTCGAAGAAGGGAGG + Intergenic
936835027 2:116699263-116699285 TAGTCCACCTGGAAGCCAGGAGG + Intergenic
938630789 2:133165021-133165043 AATGTCACCTAGAAGAGGGGAGG - Intronic
939235333 2:139485119-139485141 TGGGACAACTGGAAGAGGGGAGG - Intergenic
946223065 2:218245833-218245855 TAGTTCAGCTGGTAGAGCAGAGG + Intronic
946270797 2:218591780-218591802 TACTTCATCTGGAAGAGAGGAGG + Intronic
947741953 2:232488644-232488666 CAGTTTACCTGGAAGAAGGCAGG - Intergenic
948047606 2:234955642-234955664 CTGTTCACCTGGAAGATGGGAGG - Intronic
948149634 2:235734805-235734827 AAGTTCACATGGAAGAGAGGAGG + Intronic
1169207296 20:3747703-3747725 AAGTTCTCCTGGAAGTGGGGTGG + Intronic
1170600285 20:17836419-17836441 TAGCTTTTCTGGAAGAGGGGTGG - Intergenic
1172221851 20:33279642-33279664 TACTTCATCTGGAAAATGGGAGG + Intronic
1173199406 20:40943718-40943740 GAGTTTACCTGGGGGAGGGGAGG - Intergenic
1173915023 20:46701195-46701217 TGATTCACATGGAAGAGGAGTGG - Intergenic
1179028415 21:37699514-37699536 TTGTTCCTCTGGCAGAGGGGAGG + Intronic
1180868839 22:19134741-19134763 TCGTTCCCCTTGGAGAGGGGTGG - Intronic
1181965066 22:26650740-26650762 TTGTTCAGCTGGCTGAGGGGTGG + Intergenic
1184058062 22:42065892-42065914 TAGTTCACCTGGATGTCGAGGGG + Exonic
1185010841 22:48313088-48313110 CAGTTCACCTGGGAGGGGGTGGG + Intergenic
950586508 3:13895922-13895944 CAGTTCACCTGGGAGCGGGTGGG + Intergenic
950698388 3:14722232-14722254 TAGTGCCCCTGGAAGAAGGAGGG + Intronic
952566726 3:34668346-34668368 TAGTGCGGATGGAAGAGGGGTGG - Intergenic
953662204 3:44899486-44899508 TAGGGAACCTGGAAAAGGGGAGG - Intronic
957690185 3:83556486-83556508 GAGTTCCCCCGGGAGAGGGGTGG - Intergenic
961441824 3:126957945-126957967 TAGGCCATCTGGAAGAGGAGTGG + Intronic
963432996 3:145233340-145233362 TATTTAACGTGGAAGTGGGGAGG - Intergenic
963783506 3:149510286-149510308 TAATATACCTGGAAGTGGGGCGG - Intergenic
965742964 3:171896008-171896030 CAGTTCATCTGGAAGCTGGGCGG + Intronic
968469150 4:770307-770329 TGGTTAACCTGGGAGTGGGGAGG - Exonic
975248049 4:72143166-72143188 TAGTTCAGCTGGAACAAGGCAGG + Intronic
975860580 4:78672571-78672593 TAGTCCACATGGAAGAGGACAGG - Intergenic
976122642 4:81799990-81800012 GAGTTCACCTGGAAGAGGCCAGG + Intronic
976252239 4:83064517-83064539 TAGTACAGCAGGCAGAGGGGAGG - Intronic
976608834 4:87007834-87007856 TAGTTCACCTTGGAGAGGGTGGG + Intronic
977177667 4:93835989-93836011 AAGTTGACCAGGAAGATGGGAGG + Intergenic
977411496 4:96671965-96671987 TAGGACAACTGGAAGTGGGGAGG + Intergenic
980988266 4:139716422-139716444 TAGTTCATCTGGAGGTAGGGAGG - Intronic
981459756 4:144999503-144999525 TAGTTCTCCTTGAAGAGAAGTGG - Intronic
987025504 5:13922868-13922890 TAGTGCACCTGTCAGAGGGAAGG + Intronic
987400402 5:17469708-17469730 TATAGCACCTGGAAGGGGGGAGG + Intergenic
988093971 5:26578838-26578860 TATTTCAGCTGGAGGAAGGGTGG + Intergenic
988130037 5:27092122-27092144 TAGTTCCCCAGGGAGAGGGCTGG - Intronic
989563845 5:42881272-42881294 TGGTTCACCTGAAAGATGGAAGG + Intronic
990237872 5:53787338-53787360 TTTTTAACCTGGAAGAGGAGAGG - Intergenic
990905968 5:60803296-60803318 TAGCTCACATGGAAGAAGGAAGG + Intronic
990953743 5:61323406-61323428 GAGTTCACCCTGGAGAGGGGAGG - Intergenic
991448542 5:66726922-66726944 TAGATCATTTGGCAGAGGGGTGG + Intronic
991707461 5:69371439-69371461 TAATTCACCTGGGGGGGGGGGGG - Exonic
992743394 5:79795812-79795834 CAGTCCACCAGGAGGAGGGGAGG + Intronic
992995461 5:82328401-82328423 TAGGTGAGCTGGAAGAGGTGGGG - Intronic
995173749 5:109149291-109149313 TAGTTCACTTGTAATAGGGATGG + Intronic
998231413 5:140363583-140363605 TAGGTGACCTGGGGGAGGGGAGG + Intronic
1000233335 5:159335495-159335517 AAGTACACTTGGAAGAGGGAGGG - Intergenic
1001881322 5:175246706-175246728 TGGTCCAGCAGGAAGAGGGGTGG - Intergenic
1001937476 5:175715577-175715599 CAGTTCCCCTGGAGGAGCGGAGG - Intergenic
1003125061 6:3349315-3349337 TAGGTCCCCAGGAAGTGGGGAGG - Intronic
1005259489 6:24042783-24042805 TAGTTCACCAGGAAAATGGGGGG + Intergenic
1005520239 6:26594881-26594903 TAGCTCAGCTGGTAGAGCGGAGG + Intergenic
1006671361 6:35731698-35731720 TAGTTCACCCGGGTGAGGGTGGG - Intergenic
1006918981 6:37615296-37615318 GAGTTCCCCTGGCAGAGGGTAGG - Intergenic
1007736196 6:43983651-43983673 GAGATCACCTGGAAGAGGAGAGG - Intergenic
1008417585 6:51261002-51261024 TATCTCACATGGAAGATGGGTGG + Intergenic
1012556346 6:100517260-100517282 CTGTTCATCTGGATGAGGGGTGG - Intronic
1015721973 6:136251676-136251698 TAGTGCAGCTGGAAGAGTAGTGG - Intergenic
1017271047 6:152505686-152505708 TAGCTCAGCTGGTAGAGCGGAGG - Intronic
1018902123 6:168056947-168056969 AGGTTCACCTGTAAGAGGTGTGG - Exonic
1020129583 7:5552199-5552221 TTGCCCACCTGGATGAGGGGAGG + Intronic
1020283859 7:6665029-6665051 TAGCGTACCTGGAAGAAGGGGGG - Intergenic
1026070433 7:67114141-67114163 TAGCTCAGGAGGAAGAGGGGAGG - Intronic
1027573744 7:79905731-79905753 TGGCTCTCCTGGTAGAGGGGAGG + Intergenic
1029412615 7:100425085-100425107 TAATTCACCTGAAACAGAGGAGG - Exonic
1030555788 7:111022110-111022132 TGGTTCACTTGGAAGAAGGGTGG - Intronic
1033013654 7:137649187-137649209 TAGTTACCATGGAGGAGGGGAGG + Intronic
1035377245 7:158413636-158413658 TAGTCCTCCCGGGAGAGGGGTGG - Intronic
1036671555 8:10791870-10791892 TTGTCAACCTGGAAGAGGGCAGG - Intronic
1037824315 8:22151875-22151897 TTGTGCTCCTGGAAGCGGGGCGG + Exonic
1042142915 8:65697355-65697377 TAGCTCAGCTGGTAGAGCGGAGG - Intronic
1042183338 8:66113374-66113396 TAGCTCAGCTGGTAGAGCGGAGG + Intergenic
1042183454 8:66113995-66114017 TAGCTCAGCTGGTAGAGCGGAGG + Intergenic
1045685489 8:104707133-104707155 TCCTTCACCTGGGAAAGGGGTGG - Intronic
1047779738 8:128101409-128101431 TAGTTCTCCTGGCAGAGAGATGG + Intergenic
1050243272 9:3659841-3659863 GAGATCACCTGGGAGATGGGAGG - Intergenic
1052964850 9:34332276-34332298 TAGTTTACCAGGCAGAAGGGAGG - Intronic
1053466654 9:38313356-38313378 TAGCTCAGCTGGAAAAGGGAAGG - Intergenic
1056580514 9:87885911-87885933 AGGTTCACCTGGAAGAGAAGTGG - Exonic
1057485970 9:95484576-95484598 TATTTTTCCTGGAAGAGGTGAGG - Intronic
1060102368 9:120851761-120851783 TTGTTTACCTGGAAGAGTGTGGG + Intergenic
1061207588 9:129173816-129173838 CAGATCACCCGGCAGAGGGGAGG + Intergenic
1061290779 9:129649311-129649333 TACCTCACCTGGGAGAGGCGGGG - Intergenic
1062150888 9:135018520-135018542 CAGTGCACCTGGCACAGGGGAGG - Intergenic
1062150946 9:135018721-135018743 TGGTGCACCTGGCACAGGGGAGG - Intergenic
1186504876 X:10083236-10083258 TTGTGCTCCTGGAAGAGAGGCGG + Intronic
1187786006 X:22887381-22887403 TAGTTCACCTGGAAAGGGCATGG - Intergenic
1190852714 X:54262314-54262336 TAGTTATCCAGGAATAGGGGAGG - Intronic
1190968287 X:55323499-55323521 CAGTTGGCCTGGCAGAGGGGTGG + Intergenic
1190968324 X:55323619-55323641 GGGTTGACCTGGAAGTGGGGTGG + Intergenic
1192016947 X:67341389-67341411 TATTTCACCTACAAGAAGGGAGG - Intergenic
1192362952 X:70450624-70450646 TTGTTCACCTAGAAGAGGAGAGG - Exonic
1195450288 X:105003835-105003857 TATTTCTCATGGAAGAGAGGAGG - Intronic
1195875425 X:109535725-109535747 TAGATCACCCTGAAGAAGGGAGG + Intergenic
1196647426 X:118132968-118132990 TATTTCACCTGGCAGAGATGAGG + Intergenic
1197539186 X:127733898-127733920 TTGTGCCTCTGGAAGAGGGGAGG + Intergenic
1198725983 X:139677347-139677369 AAGTACACTTGGAAGAGGGTCGG - Intronic