ID: 1130985571

View in Genome Browser
Species Human (GRCh38)
Location 15:88842538-88842560
Sequence TGCCCACAGCTCCTCCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 0, 2: 6, 3: 52, 4: 454}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130985565_1130985571 -5 Left 1130985565 15:88842520-88842542 CCCCCTACCTGAGCACAGTGCCC 0: 1
1: 0
2: 2
3: 20
4: 309
Right 1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG 0: 1
1: 0
2: 6
3: 52
4: 454
1130985567_1130985571 -7 Left 1130985567 15:88842522-88842544 CCCTACCTGAGCACAGTGCCCAC 0: 1
1: 0
2: 3
3: 20
4: 185
Right 1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG 0: 1
1: 0
2: 6
3: 52
4: 454
1130985553_1130985571 17 Left 1130985553 15:88842498-88842520 CCCTCCCTGCCCATCCCCCCTCC 0: 1
1: 0
2: 50
3: 586
4: 4309
Right 1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG 0: 1
1: 0
2: 6
3: 52
4: 454
1130985559_1130985571 3 Left 1130985559 15:88842512-88842534 CCCCCCTCCCCCCTACCTGAGCA 0: 1
1: 0
2: 1
3: 56
4: 616
Right 1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG 0: 1
1: 0
2: 6
3: 52
4: 454
1130985552_1130985571 20 Left 1130985552 15:88842495-88842517 CCTCCCTCCCTGCCCATCCCCCC 0: 1
1: 1
2: 44
3: 514
4: 4119
Right 1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG 0: 1
1: 0
2: 6
3: 52
4: 454
1130985566_1130985571 -6 Left 1130985566 15:88842521-88842543 CCCCTACCTGAGCACAGTGCCCA 0: 1
1: 0
2: 1
3: 21
4: 268
Right 1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG 0: 1
1: 0
2: 6
3: 52
4: 454
1130985561_1130985571 1 Left 1130985561 15:88842514-88842536 CCCCTCCCCCCTACCTGAGCACA 0: 1
1: 0
2: 4
3: 32
4: 416
Right 1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG 0: 1
1: 0
2: 6
3: 52
4: 454
1130985563_1130985571 -1 Left 1130985563 15:88842516-88842538 CCTCCCCCCTACCTGAGCACAGT 0: 1
1: 0
2: 1
3: 19
4: 303
Right 1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG 0: 1
1: 0
2: 6
3: 52
4: 454
1130985568_1130985571 -8 Left 1130985568 15:88842523-88842545 CCTACCTGAGCACAGTGCCCACA 0: 1
1: 0
2: 8
3: 28
4: 258
Right 1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG 0: 1
1: 0
2: 6
3: 52
4: 454
1130985562_1130985571 0 Left 1130985562 15:88842515-88842537 CCCTCCCCCCTACCTGAGCACAG 0: 1
1: 0
2: 0
3: 29
4: 368
Right 1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG 0: 1
1: 0
2: 6
3: 52
4: 454
1130985557_1130985571 8 Left 1130985557 15:88842507-88842529 CCCATCCCCCCTCCCCCCTACCT 0: 1
1: 0
2: 14
3: 222
4: 2333
Right 1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG 0: 1
1: 0
2: 6
3: 52
4: 454
1130985560_1130985571 2 Left 1130985560 15:88842513-88842535 CCCCCTCCCCCCTACCTGAGCAC 0: 1
1: 0
2: 4
3: 45
4: 564
Right 1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG 0: 1
1: 0
2: 6
3: 52
4: 454
1130985558_1130985571 7 Left 1130985558 15:88842508-88842530 CCATCCCCCCTCCCCCCTACCTG 0: 1
1: 2
2: 64
3: 1007
4: 11136
Right 1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG 0: 1
1: 0
2: 6
3: 52
4: 454
1130985555_1130985571 13 Left 1130985555 15:88842502-88842524 CCCTGCCCATCCCCCCTCCCCCC 0: 1
1: 3
2: 44
3: 680
4: 5384
Right 1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG 0: 1
1: 0
2: 6
3: 52
4: 454
1130985554_1130985571 16 Left 1130985554 15:88842499-88842521 CCTCCCTGCCCATCCCCCCTCCC 0: 1
1: 0
2: 59
3: 537
4: 4226
Right 1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG 0: 1
1: 0
2: 6
3: 52
4: 454
1130985556_1130985571 12 Left 1130985556 15:88842503-88842525 CCTGCCCATCCCCCCTCCCCCCT 0: 1
1: 1
2: 27
3: 338
4: 3171
Right 1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG 0: 1
1: 0
2: 6
3: 52
4: 454
1130985564_1130985571 -4 Left 1130985564 15:88842519-88842541 CCCCCCTACCTGAGCACAGTGCC 0: 1
1: 0
2: 2
3: 22
4: 213
Right 1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG 0: 1
1: 0
2: 6
3: 52
4: 454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130985571 Original CRISPR TGCCCACAGCTCCTCCAGGC TGG Intronic
900117342 1:1034248-1034270 TGCCCACAGCCTCCCCGGGCTGG - Intronic
900227268 1:1539260-1539282 TGCCCAGTGCCCCTCAAGGCAGG + Intronic
900488603 1:2935329-2935351 AGCCCCCAGCTCCTCCCTGCTGG + Intergenic
900490912 1:2948731-2948753 TGCCCTCTGCTCCTGCAGCCAGG + Intergenic
900546411 1:3231703-3231725 TGCCCACATCTCAGCAAGGCTGG + Intronic
900662047 1:3789655-3789677 TCCCCACAGAGCCTCCAGGCAGG - Intronic
901166632 1:7226013-7226035 TGTCCACAGCCCCTTGAGGCAGG + Intronic
901201455 1:7469645-7469667 AGCCACCCGCTCCTCCAGGCTGG + Intronic
901664639 1:10819444-10819466 TCCCCAGAGCACCTCCAGGGAGG - Intergenic
902589102 1:17460705-17460727 TTCCCAGGGCTCCTCCAGGGTGG + Intergenic
902604410 1:17560884-17560906 TCCCCACAGTGCCTCCTGGCAGG - Intronic
902607086 1:17574789-17574811 GGCCCACGGCTCCCCCACGCAGG - Intronic
902713018 1:18253480-18253502 TGCCCAGAGAACCCCCAGGCTGG + Intronic
902873692 1:19328691-19328713 TGTCCACACCTCCTCCTGCCTGG - Exonic
902879122 1:19359456-19359478 TGCCCAGGGCTCCCTCAGGCAGG + Intronic
902961101 1:19963298-19963320 TGCCCCCAGCCTCTCCATGCAGG + Intergenic
903018455 1:20377143-20377165 TACCCTCAGCTCCTCGTGGCTGG + Intergenic
903187805 1:21639177-21639199 TGCCCTGAGCTGCCCCAGGCTGG + Intronic
903286689 1:22281863-22281885 TGACCACACCATCTCCAGGCTGG + Intergenic
903372676 1:22846962-22846984 TGGCCTCACCTCCTCAAGGCTGG - Intronic
904120414 1:28194232-28194254 TGTCCCCATCTCCCCCAGGCTGG - Intergenic
904120444 1:28194320-28194342 TGTCCCCATCTCCCCCAGGCTGG - Intergenic
904811717 1:33167516-33167538 GGCCCACAAGTCCTCCAGGGTGG + Intronic
905043186 1:34976911-34976933 TGCCCAGCGGTGCTCCAGGCAGG + Intergenic
905283254 1:36862648-36862670 CTCCCTCAGCTCCTCCAGGGCGG + Intronic
906147935 1:43570948-43570970 TTCTCATAGTTCCTCCAGGCAGG + Intronic
906607242 1:47181117-47181139 AGCCCACCCCTCCTGCAGGCTGG + Intergenic
907508846 1:54943520-54943542 TTCTCACAGCTCCACTAGGCAGG - Intergenic
908388635 1:63665549-63665571 TGCCTACAGTTCTCCCAGGCTGG + Intergenic
909273513 1:73654793-73654815 GACCCACAGCTCCTCATGGCTGG - Intergenic
909468500 1:76001022-76001044 TGCCTGCAGCTCTTCTAGGCTGG + Intergenic
909542626 1:76807663-76807685 TGCCTGCAGCTTCCCCAGGCTGG - Intergenic
909741710 1:79037368-79037390 TTCCCACAGCTCCACTAGGCAGG - Intergenic
909861140 1:80607167-80607189 TGCCTGCAGCTCTTCTAGGCTGG - Intergenic
911246672 1:95525629-95525651 TGCCTATAGCTCTCCCAGGCTGG - Intergenic
912084532 1:105982268-105982290 TTCTCACAGCTCCCCCAGGCAGG - Intergenic
912469289 1:109895587-109895609 TGCCTTCTGCTCCACCAGGCTGG - Intergenic
914517228 1:148384233-148384255 TTGCCTCAGCTCCTCCATGCAGG - Intergenic
915111496 1:153566850-153566872 TATCCAAAGCTCCTCCTGGCAGG - Intronic
915364412 1:155306386-155306408 TGGCCTCACCTCCTCCAGTCTGG - Intergenic
915936213 1:160091704-160091726 TGCCTACTCCTCCTCCAGGTGGG + Intronic
917034703 1:170735650-170735672 TCCCCACTGCTCCCACAGGCTGG + Intronic
918180509 1:182082929-182082951 TGCCCTCAGCTCCCACTGGCTGG + Intergenic
919482611 1:198108239-198108261 TACCTGCAGCTCCTCCAGGCTGG - Intergenic
919728662 1:200899557-200899579 TCTCCTCAGCTCCTCCAGGCAGG - Exonic
919796957 1:201326686-201326708 GGCCCACACCACCTCCAGCCTGG - Intronic
919835132 1:201568177-201568199 TTCCCACTGCTCCTCCAGCTTGG + Intergenic
920072407 1:203311930-203311952 TGACCACAGGTCTCCCAGGCTGG - Intergenic
920211693 1:204333131-204333153 GGCCCCCAGCTCCACCAGGCGGG + Intronic
920654974 1:207868347-207868369 TGCCCAGAACTGCCCCAGGCCGG - Intergenic
921797051 1:219358507-219358529 GGCTCACAGTTCCACCAGGCTGG + Intergenic
922413437 1:225397540-225397562 GGCCACCAGCTCCTCCAGGCTGG + Intronic
923124107 1:231020669-231020691 TGCCTCCCTCTCCTCCAGGCAGG + Intronic
1063409824 10:5828707-5828729 TGCTCAGAGCTCCTGCAGCCAGG - Intronic
1063411635 10:5840817-5840839 TGCCCACAGACCCCCCAGACAGG - Intronic
1064347735 10:14548232-14548254 TGCTCTCTTCTCCTCCAGGCAGG - Intronic
1065210322 10:23396402-23396424 AGCCCAGAGCTCCTGCAGGCTGG + Intergenic
1065628635 10:27655312-27655334 TGGTCTCAGCTCCCCCAGGCCGG + Intergenic
1066495044 10:35934466-35934488 TGCACACAGACCCTCCAGGCAGG + Intergenic
1066610733 10:37245882-37245904 TGCCTACAGTTCCTAGAGGCTGG + Intronic
1067061959 10:43082200-43082222 TTCCCACAGCTCCTCCTGGCTGG + Intronic
1067282979 10:44886945-44886967 TTCTCACAGCTCTTCGAGGCTGG - Intergenic
1067443469 10:46326383-46326405 TCCCCACAGATCCCTCAGGCTGG + Intronic
1069826111 10:71256282-71256304 TGGCCCCAGCTCCTCCAGGAAGG + Intronic
1069870439 10:71529730-71529752 CGCCCCCAGCTCCACCTGGCTGG + Intronic
1069900386 10:71703463-71703485 TCCCCACAGCACAGCCAGGCAGG - Intronic
1070651895 10:78243414-78243436 TTCTCACAGCTCCACTAGGCAGG - Intergenic
1071412727 10:85412773-85412795 TTCCCACACCTGCTCCATGCAGG + Intergenic
1071477000 10:86033674-86033696 TGGCCACTGGGCCTCCAGGCTGG + Intronic
1072674408 10:97454637-97454659 TGCCCCCAGCACCTATAGGCAGG - Intronic
1072719169 10:97770462-97770484 TCCACATAGCTCTTCCAGGCTGG - Intronic
1073773533 10:106761443-106761465 TGCCCACATCCCCTCAGGGCAGG - Intronic
1074434355 10:113421229-113421251 TGTGCATAGCTCTTCCAGGCTGG - Intergenic
1075088794 10:119431317-119431339 TGCCCCGAGCTCCTCCAGGGCGG - Intronic
1075464177 10:122639066-122639088 TTCCCACAGCTCCACCAGGCTGG + Intronic
1076426991 10:130373919-130373941 TGCCCACACCAACACCAGGCAGG + Intergenic
1077049284 11:559494-559516 CTCTCACACCTCCTCCAGGCTGG - Intronic
1077143425 11:1034771-1034793 TGCCCTCAGCCCTGCCAGGCTGG + Intronic
1077218262 11:1404133-1404155 GGCACACAGCACCTCCAGCCTGG + Intronic
1077487231 11:2844598-2844620 TGGTGACAGCTCCTCCCGGCAGG - Intronic
1078511824 11:11990194-11990216 GCCCAACAGCTCCTCCATGCAGG - Intronic
1078665268 11:13319761-13319783 TTTCCACAGCTCTGCCAGGCTGG + Intronic
1078867626 11:15312589-15312611 TGCCCATGGCTCTCCCAGGCTGG - Intergenic
1079004757 11:16783747-16783769 CGCCTGCAGCTCCTCAAGGCTGG + Intronic
1080128967 11:28770654-28770676 TGCCTACAGCTCTCCCAGGCTGG - Intergenic
1080887148 11:36377295-36377317 TGCTCACAGCCCGTCCCGGCGGG - Intronic
1081390804 11:42526551-42526573 TGCCCACAGCTCCCGGAAGCAGG + Intergenic
1081801288 11:45861015-45861037 CGCACCCAGCTCCTCCAGGGAGG - Exonic
1083051380 11:59779794-59779816 ACCTCACAGCTCCTCCAGCCAGG - Intronic
1083808080 11:65087000-65087022 GGCCCCCAGCTTCCCCAGGCCGG + Exonic
1083857359 11:65399864-65399886 TGCCCCCAGCTCCTCCAGGGTGG + Intronic
1084442581 11:69183438-69183460 TGCCCCCAGCTCCTCTGAGCTGG + Intergenic
1084602201 11:70152555-70152577 TTCCCGCAGTTCCTCCACGCGGG + Intronic
1084712669 11:70853553-70853575 TCCCAACAGCTCCACCAGCCCGG + Intronic
1084815386 11:71642822-71642844 GACCCACAGCTCCTCCTGGAGGG + Intergenic
1084888370 11:72224645-72224667 TGCCCCCAGCTCCTCCTGCGGGG - Intronic
1085052793 11:73388450-73388472 TGTCCACACCTCTTCCAGGGAGG - Intronic
1085409220 11:76281708-76281730 TGCCCACACCTCCCCTAGGTGGG + Intergenic
1085526862 11:77169263-77169285 TGCCCACGGCTGCCCCAGGGAGG - Intronic
1086273609 11:85097292-85097314 TGCCCAAAGCCCCGTCAGGCAGG + Intronic
1086381675 11:86261465-86261487 TGCCTGCAGCTCTTGCAGGCTGG + Intronic
1086576243 11:88341736-88341758 TGCCCTCAGCTTTCCCAGGCAGG + Intergenic
1087792955 11:102426492-102426514 GACCCACATCTACTCCAGGCTGG - Intronic
1087817987 11:102679810-102679832 TGCCTTCTGCTCCCCCAGGCTGG - Intergenic
1088625750 11:111729211-111729233 TGTCCACATCTTCTCCAGGCAGG + Exonic
1089209384 11:116790182-116790204 TTCCCACAGGTCATCCAGACGGG + Exonic
1089680663 11:120117286-120117308 TGCCCGGGGCTCCTGCAGGCTGG + Intronic
1089800695 11:121024428-121024450 TCCCCACAGCTGCTCGAGACAGG - Intronic
1090513402 11:127399172-127399194 TATCCACAGCTCCTCCAGGATGG + Intergenic
1091335357 11:134762273-134762295 CGCCCCCAGCCTCTCCAGGCCGG - Intergenic
1092427629 12:8387227-8387249 GACCCACAGCTCCTCCTGGAGGG - Intergenic
1092428895 12:8394208-8394230 GACCCACAGCTCCTCCTGGAGGG - Intergenic
1094056657 12:26275149-26275171 TAATCACAGCTCCTCCAGCCAGG + Intronic
1094386096 12:29895631-29895653 TGCCTGCAGCTCTCCCAGGCTGG + Intergenic
1095968051 12:47882689-47882711 TGCCCCCTGCTCCTTCAGGTAGG - Exonic
1095984605 12:47991119-47991141 TGGCCACAGCCCCTCTGGGCTGG + Intronic
1096648733 12:53051695-53051717 TGGCCACAGCTGCTTCAGGGCGG - Intronic
1096689380 12:53310071-53310093 TGCCCACAGGCCATCCAGCCTGG + Intronic
1096805990 12:54141360-54141382 TACCCCCAGCTAATCCAGGCAGG - Intergenic
1096917025 12:55044390-55044412 TGCTCACAGCTGCTCAGGGCAGG + Intergenic
1097641911 12:62192191-62192213 TGCCCGCAGCACTTCGAGGCGGG - Exonic
1100433981 12:94554695-94554717 TGCCCACATCTCCACCATGTGGG - Intergenic
1101302261 12:103495118-103495140 TGCCCACATCTGCTCCCTGCTGG - Intronic
1102646708 12:114408476-114408498 TGCCCAGAGCTCCTCCGCGGGGG - Intergenic
1103403381 12:120658471-120658493 AGCTCCCAGCTCCGCCAGGCTGG - Intronic
1103458920 12:121088669-121088691 TATACACAGCACCTCCAGGCTGG + Intergenic
1103900209 12:124299898-124299920 TGCCCACAGCTCTGCCGGGCAGG - Intronic
1104365242 12:128170794-128170816 TGCCCAAAGCTCTCCCGGGCAGG + Intergenic
1104642747 12:130477911-130477933 TGCCCTCTCCTCCTCCTGGCAGG - Intronic
1104767541 12:131340277-131340299 TGCCCCCACCACCTCCACGCTGG - Intergenic
1106094337 13:26629444-26629466 TGCCCACAGCTCCACCTGCTGGG + Intronic
1106361947 13:29039067-29039089 TCCCCAAGGCTCCTCCTGGCTGG - Intronic
1106377644 13:29204516-29204538 TTCCCAAGGCTCCTCCTGGCTGG - Intronic
1107432564 13:40352979-40353001 TGCCCACAGCTGCCCCAGCCTGG + Intergenic
1107555777 13:41515873-41515895 CGTCCCCAGCTCCTCCTGGCTGG - Intergenic
1107561445 13:41560677-41560699 TCCTCACAGCTCCTTCAGACAGG - Intergenic
1107731488 13:43353555-43353577 TGTCCTCAGCTCCTCCTGTCTGG + Intronic
1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG + Intronic
1109013134 13:56975426-56975448 TTCTCACAGCTCCACTAGGCAGG + Intergenic
1109182402 13:59229573-59229595 TGCCCAGCTCGCCTCCAGGCTGG - Intergenic
1109512982 13:63404065-63404087 TTCTCACAGCTCCACCATGCTGG + Intergenic
1111621629 13:90732115-90732137 TTCTCACAGCTCCACTAGGCAGG - Intergenic
1111946802 13:94674136-94674158 TGCCCACAACTGCTGAAGGCAGG - Intergenic
1112309000 13:98301193-98301215 TGCCCAGGGCTCCTCCAGGTGGG - Intronic
1112433458 13:99373542-99373564 GGCTCACAGCTCCTCAGGGCAGG - Intronic
1112881347 13:104109682-104109704 TTCTCACAGCTCCACTAGGCAGG - Intergenic
1113231677 13:108218733-108218755 AGCCGCCGGCTCCTCCAGGCGGG + Intronic
1113644984 13:111988333-111988355 TGCCTGCAGCTCTCCCAGGCTGG - Intergenic
1113948669 13:114059220-114059242 TGACGGCGGCTCCTCCAGGCGGG - Intronic
1117043764 14:51791815-51791837 TCCCCACAGCTTCTCAAGGTTGG - Intergenic
1117953856 14:61107867-61107889 TGCCCACTGCTCCACCAGCAAGG - Intergenic
1117988420 14:61410911-61410933 TGTCCACAGCTCTTCCTGACAGG - Intronic
1119764704 14:77181251-77181273 TGGCCACAGCCCCACCAGGGAGG - Intronic
1121623961 14:95371295-95371317 TGCCTACAGGGCCTGCAGGCTGG + Intergenic
1122283633 14:100638576-100638598 TGCCCACGACTCCTCCACTCAGG + Intergenic
1122296068 14:100706358-100706380 GGCCCACAGCTGCTCTAGCCTGG - Intergenic
1122356796 14:101127525-101127547 TGCCCACAACAACCCCAGGCAGG + Intergenic
1122534461 14:102452514-102452536 CGCCCACAGCGCATCCTGGCAGG - Exonic
1122539564 14:102490388-102490410 TGCCCAGAGCCCCAGCAGGCAGG + Intronic
1123056933 14:105575154-105575176 CGCCCACCCCTCCCCCAGGCAGG + Intergenic
1123081277 14:105696631-105696653 CGCCCACCCCTCCCCCAGGCAGG - Intergenic
1124461286 15:29894636-29894658 TGCCTGCAGCTCTCCCAGGCTGG + Intronic
1125510801 15:40291453-40291475 CTCCCGGAGCTCCTCCAGGCTGG + Exonic
1125907273 15:43404529-43404551 TGCCCAGAGTTCCACCAGCCTGG - Exonic
1126579805 15:50232513-50232535 AGCCCAGAGCTCCTATAGGCTGG + Intronic
1127540330 15:59931459-59931481 TGCCTACATCTCCTCCAGCATGG + Intergenic
1127566368 15:60193152-60193174 TGCCCCCAGCACCTCAATGCTGG + Intergenic
1128361042 15:66962004-66962026 TGCCCACTCCTCCTCCTGCCCGG + Intergenic
1128765916 15:70251063-70251085 TGCCCAGACCTCCCTCAGGCTGG + Intergenic
1129350959 15:74955855-74955877 TGGACACAGCTCCTCAAGACAGG - Exonic
1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG + Intronic
1132120631 15:99172343-99172365 TGCCCTCAGCTGCTGCAGGTTGG + Intronic
1132126123 15:99226721-99226743 TTCCCTCAGCTCCTCCACACTGG + Intronic
1132219822 15:100096965-100096987 TGCCCACAGCTCATTCAGGCAGG + Intronic
1132668247 16:1091496-1091518 GGGCCACAGCTGCTCCAGCCGGG + Intronic
1134438382 16:14282345-14282367 TTCCCCCAGCTCCTCCATCCTGG - Intergenic
1135628106 16:24013909-24013931 TGCACACAGCAAGTCCAGGCAGG - Intronic
1135899659 16:26445214-26445236 TGCCCAGAGCTTCTCCACCCTGG - Intergenic
1136020028 16:27434329-27434351 TCCCCACTGACCCTCCAGGCTGG + Exonic
1136043313 16:27597281-27597303 TGGCAACAGCTACTCCAGGATGG - Intronic
1136455461 16:30377650-30377672 GGTCAGCAGCTCCTCCAGGCTGG - Exonic
1136551765 16:30985801-30985823 TGTCTTCAGCTCCTCCAGCCAGG - Exonic
1136608962 16:31354910-31354932 TGCCCAAACCCCCTCCAGTCTGG + Intergenic
1136635761 16:31521909-31521931 TGCCCCCAAATCCTCCAGCCTGG + Intergenic
1136750226 16:32628888-32628910 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1137044405 16:35642471-35642493 TGCCATCAGCACCTCCAGCCTGG - Intergenic
1137270937 16:46901847-46901869 AGCCCACACCCCATCCAGGCTGG - Intronic
1137605694 16:49785664-49785686 GGCCCTCAGCTCCTGCTGGCTGG - Intronic
1138516789 16:57540560-57540582 TGCCTCCTGCTCCTCCAGGAAGG - Intergenic
1139366602 16:66437530-66437552 CACCCACAGCCCCTGCAGGCTGG - Intronic
1140769609 16:78191238-78191260 GGCCCACAGCTCCTCCACCTGGG + Intronic
1142009149 16:87704979-87705001 GGGCCACAGCTCCTCCTCGCAGG - Intronic
1142246989 16:88974776-88974798 TGGCCCCCGCTCCTCCAGCCAGG + Intronic
1142355599 16:89600162-89600184 TGTCCACAGCTCCTCAAGCCAGG - Intergenic
1142416831 16:89947889-89947911 TGTCCTCAGCTCCTCCCTGCGGG + Intergenic
1203052357 16_KI270728v1_random:888093-888115 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1142765086 17:2060112-2060134 TGCGCACCCATCCTCCAGGCAGG + Exonic
1142966265 17:3583688-3583710 GGCCCAGAGCTCCTCCTGGCTGG + Intronic
1143030137 17:3963339-3963361 TCCCCACATCCCTTCCAGGCAGG - Intronic
1143783253 17:9240287-9240309 TGCCCCCAGCCCCTCCACGGCGG - Exonic
1143929002 17:10400756-10400778 TTCCCCCAGCTCCTCAATGCGGG + Exonic
1146261909 17:31427515-31427537 TGTCCACAGCTCCCTGAGGCTGG - Intronic
1146986257 17:37221723-37221745 TGCCCACATCTCATCCAAACAGG - Exonic
1148711099 17:49681556-49681578 TGCCAACAGCTTGTCCAGGCTGG + Intergenic
1149779745 17:59387935-59387957 TGGCCACAGCTTTCCCAGGCTGG - Intronic
1150525590 17:65919094-65919116 TGCCCTCAGATCCCCCAGGGGGG - Intronic
1151444224 17:74152719-74152741 TGCCCCCGGCTCCTCCAACCTGG - Intergenic
1152128575 17:78462205-78462227 TGGCCAGGGCCCCTCCAGGCTGG + Intronic
1152330374 17:79669258-79669280 TGCCCACCTGCCCTCCAGGCAGG + Intergenic
1152545274 17:80997310-80997332 TGCGCTCAGCTCCTCCAGGATGG - Exonic
1152561008 17:81078775-81078797 TGCTCTCTGCTGCTCCAGGCTGG + Intronic
1156846790 18:41674903-41674925 TGCCCAAAGAGCCTCCAGACAGG + Intergenic
1157471514 18:47992457-47992479 TGCTCACAACTCCTCCTGCCAGG - Intergenic
1157533513 18:48441800-48441822 TGCACACAGCTTCGCCGGGCTGG - Intergenic
1157718626 18:49906550-49906572 AGCCCGCAGCTTCTCCAGGTAGG + Exonic
1160007302 18:75076819-75076841 AGGCCACAGCCCCTCCTGGCAGG + Intergenic
1160184064 18:76660909-76660931 TGTCCCCAGCCCCTCCAGGGCGG - Intergenic
1160187089 18:76684375-76684397 GCCCCACGGCTCCTCCTGGCAGG + Intergenic
1160266185 18:77342215-77342237 CGCCCAAAGCTCCTCCTTGCTGG + Intergenic
1160417482 18:78721315-78721337 CTTCCACAGCTCCTCCAGGACGG - Intergenic
1160837337 19:1131147-1131169 CCTCCACAGCCCCTCCAGGCCGG + Intronic
1161326706 19:3667679-3667701 TCCCCTCCCCTCCTCCAGGCAGG - Intronic
1161341851 19:3747355-3747377 TCAAAACAGCTCCTCCAGGCTGG - Intronic
1161378930 19:3954313-3954335 AGCCCTCAGCTCCCACAGGCTGG - Intergenic
1161664382 19:5565948-5565970 TTCCCAGAGCTGCCCCAGGCCGG + Intergenic
1162003258 19:7761359-7761381 TGCTCCCAGCTGATCCAGGCTGG + Intergenic
1162033472 19:7927059-7927081 TGCCCCCAGCTCTGCCAGGACGG - Exonic
1162035284 19:7935028-7935050 TGGCCCCAGCGGCTCCAGGCGGG + Intronic
1162142864 19:8595305-8595327 GGCTCAGAGCTCCTCCAGACAGG + Intronic
1162323907 19:9987016-9987038 TGTCCACAGTTCCTTCTGGCAGG + Intronic
1164418551 19:28067158-28067180 TCCCGACAGGTCCTCCAGGGAGG - Intergenic
1164789293 19:30962233-30962255 TGCCCACCCCTCCTCCACACAGG + Intergenic
1164908557 19:31986946-31986968 TCTCCACAGCTCCCCCAAGCAGG + Intergenic
1165762418 19:38329473-38329495 TGCACACAGCTCCTCCCACCTGG - Intergenic
1166214510 19:41326429-41326451 TGCTCACAGCACCCACAGGCTGG + Intronic
1166735566 19:45082206-45082228 TGCCCCCACCTCCTCCACACTGG + Intronic
1167558008 19:50207509-50207531 GGCCAGGAGCTCCTCCAGGCAGG + Intronic
1168528547 19:57107017-57107039 TGCCCAGAGCTCCGATAGGCGGG + Intergenic
1168534175 19:57155173-57155195 AGCCGACAGCTCCTCCTGGGAGG - Intronic
1168583686 19:57576109-57576131 TTCCCACAGCACCAACAGGCAGG + Intronic
925070171 2:960511-960533 TGCTCCCAGCTCCTCCACGAGGG - Intronic
925337493 2:3108846-3108868 TGCCCTCGCCTTCTCCAGGCAGG + Intergenic
925907653 2:8548777-8548799 TGCCCAGAGCTCAATCAGGCAGG + Intergenic
926120368 2:10238355-10238377 TGCCCACCGCCCCTCCCGGAAGG + Intergenic
926165961 2:10522325-10522347 TGCCACCAGCTTCTCCTGGCTGG + Intergenic
926619339 2:15033056-15033078 TCCCCAGAGCTCTGCCAGGCAGG - Intergenic
928392372 2:30919465-30919487 TGCCCACAGTCTCTGCAGGCAGG - Intronic
929014439 2:37481109-37481131 TGGCAACAGCTGCTCCAGGCAGG - Intergenic
929044684 2:37778107-37778129 TTCCCATAGAGCCTCCAGGCTGG + Intergenic
931779424 2:65566625-65566647 TTCCCAGAGCTTCTCCTGGCAGG - Intergenic
932135236 2:69223087-69223109 TGATCACAGCTACTCCAGGCTGG - Intronic
932414497 2:71565483-71565505 TCCCCAAAGCCCCTCCACGCTGG + Intronic
934714142 2:96533528-96533550 TGGCCAAAGCTCTTTCAGGCAGG + Intergenic
936380721 2:111983502-111983524 TGCCCGCAGCTGTGCCAGGCTGG - Intronic
937142229 2:119612031-119612053 TGTCCACAGGTCCTCAAGGTGGG + Intronic
937337893 2:121072889-121072911 TGCCCCCAGGAACTCCAGGCTGG - Intergenic
937982776 2:127624912-127624934 TGCCCATGCCTCTTCCAGGCGGG - Intronic
938293093 2:130160706-130160728 GGGTCACAGCACCTCCAGGCTGG + Intronic
938370219 2:130763760-130763782 TGCCCACAGCTCCTGCCTGCTGG - Exonic
938463461 2:131512259-131512281 GGGTCACAGCACCTCCAGGCTGG - Intergenic
938906029 2:135836871-135836893 TGGGCACAGCTCCTCCCAGCAGG - Exonic
940621278 2:156117145-156117167 TACCCACAGCTGCTTCAGGTTGG + Intergenic
942566088 2:177265284-177265306 TGTCCACATCTCCCCTAGGCAGG - Intronic
943513260 2:188852719-188852741 TGCCCATTGCTCTTACAGGCTGG + Intergenic
943613390 2:190062333-190062355 TACCCAAAGCTCCTCCACTCCGG - Exonic
943936117 2:193919016-193919038 TTCTCACAGCTCCACTAGGCAGG - Intergenic
944379551 2:199092309-199092331 TGCCTATAGCTCTCCCAGGCTGG + Intergenic
947711435 2:232318643-232318665 TGCCCTCTGCTTCTCCCGGCTGG + Intronic
947898666 2:233700082-233700104 TGCCCTCCACACCTCCAGGCTGG - Intronic
947933808 2:233985918-233985940 TGCTCCCAGCACCTCCAGCCTGG - Intronic
948027446 2:234789373-234789395 TGCCCCCAGCTGCTCTGGGCAGG + Intergenic
948263637 2:236622216-236622238 TGCCAGCAGCTCCTCCAGTCAGG - Intergenic
948687383 2:239677644-239677666 TCCCCACACCTCCTCCAGGGGGG + Intergenic
948721504 2:239903862-239903884 GTCCCACAGCTCTTCCATGCAGG + Intronic
948864393 2:240768018-240768040 TGGGCACAGCCCCTCCTGGCTGG - Intronic
948921677 2:241068824-241068846 AGACCGCAGCTCCCCCAGGCAGG - Intronic
1169227845 20:3867099-3867121 TGCCCTCAGCTCTACCAGGTTGG - Exonic
1170735009 20:19006897-19006919 GGCCCAAAGTTCCTCCAGGGTGG + Intergenic
1172275991 20:33679690-33679712 TACTACCAGCTCCTCCAGGCTGG + Intronic
1173874052 20:46358621-46358643 TGCAGAGAGCTCCTCCAGCCTGG - Intronic
1174183372 20:48688879-48688901 GGCCCACAGCTCCTGAAAGCTGG + Intronic
1174273221 20:49384624-49384646 TGCCCGCATCCCCTACAGGCAGG + Intronic
1174443933 20:50577785-50577807 TCCCACCAGCTGCTCCAGGCAGG - Intronic
1175817461 20:61890928-61890950 TGCCCACATCTGCTGTAGGCTGG - Intronic
1175887657 20:62301959-62301981 TGCCTACAGCGACGCCAGGCGGG - Intergenic
1176114201 20:63424010-63424032 GGCCCACATCACCGCCAGGCGGG + Intronic
1178935535 21:36858724-36858746 TGCCCAGAGGTCCTCATGGCAGG - Intronic
1179247144 21:39643814-39643836 TTCCCGCAGCTCCTCGAGGCTGG + Intronic
1179251183 21:39673203-39673225 TGCCCACCGATGCTCCTGGCAGG + Intergenic
1179442856 21:41407711-41407733 TCCCCACAGCTCCTCCCTGCTGG - Intronic
1179610966 21:42549651-42549673 TGCCCTCAGCTCCCTCAGGAAGG - Intronic
1179638667 21:42732238-42732260 TGCGGGCAGCTCCTCCAGGCAGG - Intronic
1179646311 21:42778448-42778470 TGTCCACAGCTCCTCCACTGTGG + Intergenic
1179879505 21:44287495-44287517 TGCCCCCAGCTCCCCCATTCAGG + Exonic
1180055589 21:45357623-45357645 TGCCCTCAGCTCCTGCAGCTGGG + Intergenic
1180961445 22:19764161-19764183 CTTCCACAGCTCCTCCTGGCTGG + Exonic
1181133844 22:20750746-20750768 AGCTCACAGCTCCTTCAGCCTGG - Intronic
1181407513 22:22695217-22695239 TTTCCACAGGCCCTCCAGGCAGG + Intergenic
1181415508 22:22755983-22756005 TTTCCACAGGCCCTCCAGGCAGG + Intronic
1182043881 22:27259447-27259469 TGCCCATCGCTCCCCCAGCCTGG + Intergenic
1182270048 22:29147716-29147738 TGCCCTCAGCATCTCCTGGCTGG - Intronic
1182462131 22:30490566-30490588 GGGCCACAGCTCCTCCCTGCAGG - Intronic
1182555108 22:31125036-31125058 TGCCCACCGCAGCTCCAGCCTGG + Exonic
1183323909 22:37181069-37181091 TACCCACTGCTCCCCAAGGCTGG - Exonic
1183440149 22:37818363-37818385 TGGCCACAGCTACCCCAGCCAGG - Intergenic
1183727262 22:39596687-39596709 TGCCCACTGCTGCTGCAGGAAGG + Intronic
1183735770 22:39644029-39644051 TCCCCATCCCTCCTCCAGGCTGG - Intronic
1184093976 22:42306564-42306586 TGGGCCCACCTCCTCCAGGCTGG + Intronic
1184179071 22:42807128-42807150 TGCCGACAGCCTCTCTAGGCGGG + Exonic
1184501588 22:44878025-44878047 TTCCAACAGCTCCTCCAGAGGGG + Intergenic
1184644803 22:45889974-45889996 TTCCCACAGGTCCCACAGGCAGG + Intergenic
1184684398 22:46089608-46089630 TGCCAGCAGCCCCTCCAGGTGGG - Intronic
1184758420 22:46530894-46530916 TGCATACAGCACCTCCAGGCTGG + Intronic
1184760661 22:46542300-46542322 AGCCCACAGCATTTCCAGGCAGG - Intergenic
1185012022 22:48319633-48319655 TGCCCACACCTCTATCAGGCTGG - Intergenic
1185158616 22:49209108-49209130 TGACCTCACCTCCACCAGGCTGG + Intergenic
1185281731 22:49972581-49972603 CGCCCCCACCTCCTCCAGTCTGG + Intergenic
1185311484 22:50158140-50158162 GGCCCACAGCATCTCCAGTCAGG + Exonic
1185399015 22:50606417-50606439 TTCCTTCTGCTCCTCCAGGCAGG - Intronic
950016617 3:9759084-9759106 TCCCCTCAGCCCCTCCAGTCTGG + Intronic
952105353 3:30064303-30064325 TTCCCAGACTTCCTCCAGGCTGG - Intergenic
952386147 3:32843052-32843074 TGGCCACAGCCCCTCCAGCTGGG + Intronic
952423589 3:33152860-33152882 TGCCTACTGCTGCTCCTGGCAGG - Exonic
952819474 3:37473467-37473489 TTCCCACAGCACCCCCAGGAGGG - Intronic
953145445 3:40270662-40270684 TGCCCACAACTCTCCCAGACTGG + Intergenic
953582059 3:44166436-44166458 TGTCCACATGTCCTGCAGGCTGG + Intergenic
953656990 3:44861994-44862016 TTCCCTCCGCACCTCCAGGCGGG + Exonic
953772936 3:45792676-45792698 TGGCCACCGCAGCTCCAGGCCGG + Intronic
954163629 3:48739348-48739370 TGTCCCCAGCACGTCCAGGCAGG + Intronic
955343986 3:58147606-58147628 TGCCCACAGCCATGCCAGGCAGG + Intronic
956401771 3:68887400-68887422 TGCCTGCAGCTCTCCCAGGCTGG + Intronic
957072326 3:75576921-75576943 GACCCACAGCTCCTCCTGGAGGG - Intergenic
957716556 3:83935964-83935986 TCCACTCAGCTCTTCCAGGCTGG - Intergenic
959310465 3:104729574-104729596 TGCCCGCAGCTCACCAAGGCTGG + Intergenic
959460787 3:106623181-106623203 TGCCTGCAGCTCTCCCAGGCTGG + Intergenic
959838897 3:110951396-110951418 TTCTCACAGCTCCACTAGGCAGG - Intergenic
960121353 3:113951112-113951134 TGCCTCCAGCTCTCCCAGGCTGG + Intronic
961281743 3:125769850-125769872 GACCCACAGCTCCTCCTGGAGGG + Intergenic
961872602 3:129999734-129999756 GACCCACAGCTCCTCCTGGAGGG - Intergenic
963964452 3:151349962-151349984 TGACCACAGCACCTCCATGCTGG - Intronic
964306631 3:155347890-155347912 TGCCTACTGCTCCCCCAGGCTGG + Intergenic
964836196 3:160940809-160940831 TTCTCACAGCTCCACTAGGCAGG - Intronic
965858459 3:173117738-173117760 TGCCCAAAACTCCTGCAGGGGGG + Exonic
966338909 3:178903113-178903135 TGCCTACAGCTTTCCCAGGCTGG - Intergenic
967215555 3:187206988-187207010 TCCACCCAGCTCTTCCAGGCTGG + Intergenic
967439838 3:189493805-189493827 TGCCCACCTCGCCTCTAGGCTGG - Intergenic
968513433 4:1005153-1005175 TGCACACAGCACCCACAGGCTGG - Intergenic
968516822 4:1018979-1019001 TGCCTACAGCGCTTGCAGGCCGG + Intronic
968764273 4:2459881-2459903 TGCCCCCAGCCTCTCCAGCCTGG - Intronic
968936366 4:3612509-3612531 TGCCCACACCTCTCCCAGGTGGG - Intergenic
968982331 4:3856995-3857017 GGCCCACAGCTCTCCCAGGCAGG + Intergenic
969015920 4:4104236-4104258 GACCCACAGCTCCTCCTGGAGGG - Intergenic
969302267 4:6304064-6304086 TTCACGCAGCCCCTCCAGGCAGG - Intergenic
969442921 4:7227865-7227887 AGCCCACCGCACCTCCAGGGAGG - Intronic
969738033 4:9004116-9004138 GACCCACAGCTCCTCCTGGAGGG + Intergenic
969797223 4:9535663-9535685 GACCCACAGCTCCTCCTGGAGGG + Intergenic
970216738 4:13766866-13766888 TGCTCCCAGCTCTGCCAGGCAGG + Intergenic
970609181 4:17709582-17709604 TTCCCGCAGCGCCTCCATGCTGG + Exonic
970771238 4:19615085-19615107 TGCCCACAGCTCCTGTTGTCAGG + Intergenic
971098461 4:23435144-23435166 TTCCTGCAGCTCTTCCAGGCTGG - Intergenic
971117435 4:23664500-23664522 TGCCTGCAGCTCTCCCAGGCTGG - Intergenic
972485218 4:39534103-39534125 TTCTCACAGCTCCATCAGGCAGG - Intergenic
972907421 4:43768183-43768205 TGCCTTCATCTTCTCCAGGCTGG + Intergenic
975241668 4:72066870-72066892 TGCCTACAGCTCTCCCAGACTGG + Intronic
981920460 4:150079425-150079447 TTCCAGCAGCTCGTCCAGGCTGG - Exonic
982287028 4:153746467-153746489 TGCCCATAGCTCTCCTAGGCTGG + Intronic
982287033 4:153746504-153746526 TGCCCATAGCTCTCCTAGGCTGG + Intronic
982287038 4:153746541-153746563 TGCCCATAGCTCTCCTAGGCTGG + Intronic
982287043 4:153746578-153746600 TGCCCATAGCTCTCCGAGGCTGG + Intronic
982287048 4:153746615-153746637 TGCCCATAGCTCTCCTAGGCTGG + Intronic
983323441 4:166224815-166224837 TGCCCATACCTCTTCCAGGCTGG + Intergenic
985104255 4:186485688-186485710 TGCCCACAGCTTCTGGAGCCTGG + Intronic
985519576 5:367201-367223 TCCCCCCAGCTCCTCCAGGGTGG - Intronic
985688522 5:1294640-1294662 GGCCACCAGCTCCTTCAGGCAGG + Exonic
985833250 5:2251545-2251567 TGGCCAGGGCTCCTCCTGGCTGG + Intergenic
985956268 5:3268336-3268358 TGCTCACAGGTCCTAGAGGCCGG - Intergenic
986985924 5:13501016-13501038 TGCCTGCATCTCTTCCAGGCTGG - Intergenic
988167777 5:27616748-27616770 TGACCCCAGTGCCTCCAGGCTGG - Intergenic
988367820 5:30324236-30324258 TGCTCACTGCTGCCCCAGGCTGG + Intergenic
989576464 5:42992695-42992717 AGCCCGCCGCTCCTCCAAGCCGG + Intergenic
991524227 5:67538478-67538500 TGCTCACAGCACGGCCAGGCAGG - Intergenic
992564886 5:77986955-77986977 GCCCCACATCTCCTTCAGGCAGG - Intergenic
995389775 5:111627324-111627346 TTCTCACAGCTCCACTAGGCAGG - Intergenic
997449439 5:133969786-133969808 TGCCCACAGCTTCACCATTCTGG + Intergenic
997608671 5:135195040-135195062 TGCCGACAGCTCCTGTGGGCCGG + Intronic
997912441 5:137889372-137889394 AGCCCCCAGCTCCTCCAGGGCGG - Intronic
998113169 5:139517653-139517675 TGCCAACATCGACTCCAGGCTGG - Intergenic
998366944 5:141637838-141637860 CGCCCGCACCTCCTCCACGCCGG - Exonic
998953201 5:147412650-147412672 GGCCCCCAGCTCTCCCAGGCAGG + Exonic
999887324 5:155937288-155937310 TGGCAGCAGCTGCTCCAGGCAGG + Intronic
1000853297 5:166367491-166367513 TACCCACACCACCTGCAGGCTGG + Intergenic
1001031194 5:168264576-168264598 TAACAAAAGCTCCTCCAGGCAGG - Intergenic
1001163092 5:169338726-169338748 TGACCGCAGCTCCTGCAGGGTGG - Intergenic
1001492400 5:172165024-172165046 TATCCCCACCTCCTCCAGGCTGG - Intronic
1001589583 5:172856218-172856240 TGGTCACAGCTTCTCCAGCCTGG - Intronic
1002565726 5:180112245-180112267 TGTCCACATCACCTCCAGCCTGG + Intronic
1002915007 6:1521929-1521951 TTCACACAGCTCCTCAATGCAGG + Intergenic
1004076831 6:12351428-12351450 TTCTCACAGCTCCACTAGGCAGG + Intergenic
1004178451 6:13360864-13360886 TGCCCACATCTCTTCCTGGGAGG + Exonic
1004245939 6:13975244-13975266 TGCTCACAGTTCCACAAGGCTGG - Intronic
1006166857 6:32070359-32070381 CACCCACAGCTCCCCAAGGCGGG + Intronic
1006379773 6:33690789-33690811 TTCCCAAGGCTCCTCCAGGGAGG - Intronic
1007536828 6:42598794-42598816 TTCACACAGCTACTACAGGCAGG - Intronic
1009967584 6:70593510-70593532 TGCCTGCAGCTTTTCCAGGCTGG - Intergenic
1010125127 6:72422366-72422388 TGCCTACACCTTCTCCTGGCTGG + Intergenic
1011164461 6:84430678-84430700 TGCCTACAGCAACTACAGGCTGG - Intergenic
1011795442 6:90947502-90947524 TGGCTACACCTCCTCCAGCCTGG - Intergenic
1013932576 6:115551791-115551813 TGCCAACAGCTCCAGCTGGCAGG - Intergenic
1014771053 6:125458446-125458468 TTCTCACAGCTCCACTAGGCAGG + Intergenic
1016510658 6:144839263-144839285 GGCCCACAGTTCCACCAGGCAGG + Exonic
1017018277 6:150118697-150118719 TGCCCGCAGGGCCCCCAGGCAGG - Intergenic
1017753563 6:157510788-157510810 TGCGCAGAGCTCCACCAGGCAGG + Intronic
1018008183 6:159642683-159642705 TTCCCACTGCTCCTCCATTCTGG - Intergenic
1018705530 6:166461034-166461056 GGCCCACAGCTACTGCAGGAGGG + Intronic
1018934319 6:168263576-168263598 TGCCCACAGCTCCACCTCGTTGG - Intergenic
1019120567 6:169800822-169800844 TGTACACAGCTCCTTCTGGCCGG + Intergenic
1019333911 7:473691-473713 TGCCCAGAGCTCCTCGAAGTAGG - Intergenic
1019538713 7:1541856-1541878 TTCCGCCAGCTCCCCCAGGCAGG - Exonic
1019559927 7:1650927-1650949 TGCCCACCCCTCCCCCAGGCTGG + Intergenic
1019587239 7:1812305-1812327 TTCTCACAGTTGCTCCAGGCAGG + Intergenic
1019999864 7:4749567-4749589 TTCCTCCAGCCCCTCCAGGCGGG + Intronic
1020945518 7:14600890-14600912 TGCCAACAGCTCTCTCAGGCTGG + Intronic
1022206715 7:28171555-28171577 TGCCCACAGCTGCACCAGCGGGG - Intronic
1022820446 7:33954752-33954774 AGCCCACACCTCATCCAAGCTGG - Intronic
1022980610 7:35601760-35601782 AGCCCACAGCTGGGCCAGGCTGG + Intergenic
1023592959 7:41798157-41798179 TGACTACAGCTCCTACAGGGTGG - Intergenic
1024210624 7:47200357-47200379 TGCCTACAGCCCTCCCAGGCTGG + Intergenic
1024260254 7:47568984-47569006 CACCCACTCCTCCTCCAGGCAGG + Intronic
1024533560 7:50411771-50411793 CACCCGCAGCTCCTCCAGGGTGG - Intergenic
1024943103 7:54782603-54782625 TGACCACTGCACCTCCAGGAAGG + Intergenic
1025012965 7:55413664-55413686 TGCGGCCAGCTCCTCCTGGCAGG + Intronic
1025058389 7:55783828-55783850 TGCCTTCAGCTCTCCCAGGCTGG + Intergenic
1026034784 7:66823196-66823218 AGCTCACAGGTTCTCCAGGCTGG - Intergenic
1028776924 7:94687998-94688020 TGCCTGCAGCTCTCCCAGGCTGG + Intergenic
1029318884 7:99739604-99739626 GACCAACAGCTCCTACAGGCAGG + Intergenic
1029381375 7:100217350-100217372 TGGCCTCAGCTCGTCCAGCCTGG - Intronic
1029600267 7:101559161-101559183 TGCCCTCAGGACCTCCAGGGAGG + Intergenic
1030105934 7:105987370-105987392 TGTCCACCGCTCCTGCAGGCTGG - Intronic
1030107618 7:106000015-106000037 TGGCCCCAGCGCCCCCAGGCTGG - Intronic
1031299223 7:120042856-120042878 TTCTCACAGCTCCACTAGGCAGG - Intergenic
1032084932 7:128878941-128878963 TGCCCACAGCTCCTGCATGAGGG + Intronic
1032484018 7:132269403-132269425 TCTCCACAGCTCCACCAGACCGG + Intronic
1034087745 7:148335413-148335435 TGCCCACACCTCCAGCAGGGAGG + Intronic
1035382161 7:158447048-158447070 GGCCAACAGCAGCTCCAGGCAGG + Intronic
1035785949 8:2261331-2261353 CTTCCTCAGCTCCTCCAGGCAGG + Intergenic
1035806858 8:2460385-2460407 CTTCCTCAGCTCCTCCAGGCAGG - Intergenic
1036243117 8:7095390-7095412 GACCCACAGCTCCTCCTGGAGGG + Intergenic
1036257682 8:7218654-7218676 GACCCACAGCTCCTCCTGGAGGG - Intergenic
1036258933 8:7225653-7225675 GACCCACAGCTCCTCCTGGAGGG - Intergenic
1036307688 8:7613857-7613879 GACCCACAGCTCCTCCTGGAGGG + Intergenic
1036310986 8:7684249-7684271 GACCCACAGCTCCTCCTGGAGGG - Intergenic
1036691985 8:10949935-10949957 TGCTCACAGCTCCTCCAACATGG + Intronic
1036892417 8:12605094-12605116 GACCCACAGCTCCTCCTGGAGGG - Intergenic
1036898710 8:12656041-12656063 GACCCACAGCTCCTCCTGGAGGG - Intergenic
1036899961 8:12663070-12663092 GACCCACAGCTCCTCCTGGAGGG - Intergenic
1037717373 8:21411732-21411754 TGTCCCCAGCTCCTCCAGCTGGG - Intergenic
1038454979 8:27667141-27667163 TGACCAAGGCCCCTCCAGGCCGG - Intronic
1039435542 8:37556978-37557000 TCCCCACAGCTTCTCCCTGCAGG + Intergenic
1039477123 8:37844937-37844959 AGCCAGCAGCTCCTGCAGGCGGG + Exonic
1040813449 8:51481989-51482011 TTCTCACAGCTCCACTAGGCAGG - Intronic
1041021668 8:53644150-53644172 CGCGCACAGCTCTCCCAGGCAGG - Intergenic
1041152283 8:54947920-54947942 TGCCCACTGCCACTCCAGCCTGG + Intergenic
1042020575 8:64369409-64369431 GGCCCGCAGCTCCTCGCGGCCGG + Intergenic
1042737062 8:72001284-72001306 TGCCCCTGGCTCCTCCAGGAGGG - Intronic
1047393387 8:124472645-124472667 TTCACACAGCTTCTCCAAGCAGG - Intergenic
1047586933 8:126283048-126283070 TTCTCACAGCTCCACTAGGCAGG - Intergenic
1048067113 8:130981557-130981579 CTCCTGCAGCTCCTCCAGGCTGG + Intronic
1049268193 8:141680757-141680779 TGGCCACAGCACCTCCAGTCAGG - Intergenic
1049480065 8:142818365-142818387 TGCCCACTGCTCCCCAATGCTGG + Intergenic
1049588246 8:143441657-143441679 TGCCCAGAGCACCTGCTGGCTGG - Intronic
1053022881 9:34708117-34708139 TCCCCAAATCACCTCCAGGCGGG - Intergenic
1053158531 9:35796951-35796973 TGCCCACAGCTTTTCCAGGAGGG + Intronic
1053280888 9:36819226-36819248 GGCTGACAGCTCCGCCAGGCTGG + Intergenic
1053284765 9:36842941-36842963 TGCCCACACCTCGTCCAACCTGG - Intronic
1053437995 9:38089997-38090019 GGCCCAGAGCTGCTACAGGCTGG - Intergenic
1054954494 9:70893183-70893205 TCCCCACAGGTCCTCCAGATTGG + Intronic
1055945603 9:81689032-81689054 TGCCCAATGCTCCTCGAGCCCGG + Exonic
1057035814 9:91811144-91811166 TTCCCACACCTCCCCTAGGCCGG + Intronic
1057199669 9:93133499-93133521 TGCCCACAGCCCTCCCAGGCCGG + Intronic
1057216670 9:93232397-93232419 TGCTCTCAGCCCCTCCAGGAGGG - Intronic
1057220744 9:93256474-93256496 TGGCCACTGTCCCTCCAGGCAGG + Intronic
1057488726 9:95506411-95506433 CACCCACAGCTCCTCCACGTTGG + Exonic
1058271747 9:102981301-102981323 TGCCTGCAGCTCTCCCAGGCTGG - Intergenic
1058431698 9:104926606-104926628 GGCCCGCAGCGCCTCCTGGCCGG - Intronic
1058967219 9:110049031-110049053 TGGCCACAGCCCCTCCACCCGGG - Intronic
1060192017 9:121599456-121599478 CGCCCACAGCTCCGCCCGCCAGG - Intronic
1060414089 9:123418642-123418664 TGCCCACAGCACAGGCAGGCTGG - Intronic
1060829735 9:126706036-126706058 TACCCGCAGCTCCTCGAGCCCGG + Intergenic
1060932146 9:127495992-127496014 AGCCGACAGCTCCTCCAGGAGGG - Exonic
1061237824 9:129352406-129352428 TGCCCGCCCCTCCTCCGGGCCGG - Intergenic
1061307333 9:129739701-129739723 TGCCCGCAGCTTCCCCAGGTAGG + Exonic
1061714576 9:132510627-132510649 TGCCTGCAGCTCCTCCTGGCTGG - Intronic
1061774205 9:132949729-132949751 TGGCCACAGCTGCTCCTTGCTGG - Intronic
1061805997 9:133138063-133138085 GGCCCTCAGCCCCTTCAGGCAGG - Intronic
1062061039 9:134495108-134495130 TGACCACAGCTCCTCCTGGTAGG + Intergenic
1062501890 9:136855245-136855267 TGCCCTCAGATCCTCCTGGCCGG + Exonic
1062511176 9:136907037-136907059 AGCCCACTGCTGCCCCAGGCAGG - Intronic
1062515683 9:136934057-136934079 TGCCTTCAGCTCTCCCAGGCTGG - Intronic
1187045750 X:15646591-15646613 TCCCCACCGCTCCTCCCAGCTGG + Intronic
1189283844 X:39838220-39838242 TGCCCCCAGCTCTTCCTGGTTGG + Intergenic
1189880566 X:45487188-45487210 TGCCTGCAGCTCTCCCAGGCTGG - Intergenic
1191850413 X:65581954-65581976 TAGCCCCAGCTGCTCCAGGCAGG - Intergenic
1194024908 X:88739382-88739404 TGCCCACAGCTCCACTAGCCAGG + Intergenic
1194194132 X:90870809-90870831 TTCTCACAGCTCCACTAGGCAGG - Intergenic
1194205808 X:91009745-91009767 TGCCCATGGATCCTCCAGGCTGG + Intergenic
1195228611 X:102823461-102823483 TGCCTGCAGCTCTTCCAGGCTGG + Intergenic
1197586462 X:128353829-128353851 TGCCTACAGCTATCCCAGGCTGG - Intergenic
1198588585 X:138150113-138150135 TGCCTGCAGCTTTTCCAGGCAGG - Intergenic
1198979757 X:142381438-142381460 TGCCTGCAGCTTCCCCAGGCTGG - Intergenic
1199585572 X:149412727-149412749 TTCCCACAGCTTCACAAGGCAGG - Intergenic
1200551566 Y:4584556-4584578 TGCCCATGGATCCTCCAGGCTGG + Intergenic
1200687147 Y:6266903-6266925 GGCCACCAGCTCCTCCAGGGCGG - Intergenic
1201048130 Y:9907807-9907829 GGCCACCAGCTCCTCCAGGGCGG + Intergenic