ID: 1130985812

View in Genome Browser
Species Human (GRCh38)
Location 15:88843692-88843714
Sequence ATGGGGTCCTAGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 286}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130985812 Original CRISPR ATGGGGTCCTAGAGGGAAGA GGG Intronic
900717365 1:4153488-4153510 ATGGGGTCCTCAAGGGAGGTGGG + Intergenic
900908968 1:5580601-5580623 CTGGGGTCCTGGAAGGAAGAGGG - Intergenic
900993422 1:6108112-6108134 ATGGAGGCATAGAGGGATGATGG + Intronic
901929703 1:12589148-12589170 ATGGGGTGCTAGATAGCAGAGGG + Intronic
902512849 1:16975581-16975603 ATGGGGGGCTAGAGGGCACAGGG - Intronic
903124028 1:21235751-21235773 ATGGGGTGCTAGAGGCAGCATGG - Intronic
904884217 1:33724368-33724390 ATGGGGTCCCAGGAGGATGACGG - Intronic
906699691 1:47848944-47848966 ATGGGGACCCACAGGGATGAAGG - Intronic
906873755 1:49513418-49513440 ATGGAATCCTAGAGGGTGGAGGG - Intronic
907358836 1:53898281-53898303 GTGGGGTCCCAGAGGCAGGAAGG + Intronic
909207274 1:72775160-72775182 ATGGGGTCAGAAAGGGAACAGGG + Intergenic
909272837 1:73645930-73645952 AAGGGATCCTAGCAGGAAGACGG + Intergenic
909440013 1:75686547-75686569 ATGAGGTCAAAGAGGTAAGAAGG + Intergenic
909862997 1:80632646-80632668 ATGGGGAGCCAGAGGGGAGATGG - Intergenic
910884303 1:91949599-91949621 ATGGGGTCGGGGAGGGGAGAGGG - Exonic
912433440 1:109641899-109641921 ATGGGCTACTAGAGGGGAGGTGG + Intergenic
915128931 1:153683890-153683912 GTGGGGACCCAGAGGGAAGAGGG + Intronic
915943753 1:160135419-160135441 ATGGCTCCCTGGAGGGAAGACGG - Exonic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
918322167 1:183374743-183374765 ATGGCTTCCTAGAGAGAAGATGG - Intronic
919752483 1:201047000-201047022 ATGGAGACATAGAGGGAAAAAGG - Intronic
920559609 1:206930025-206930047 ATGGGTCCCTTGAAGGAAGAGGG - Exonic
922500789 1:226095526-226095548 AGGGAGTCCTAGAGGGTGGAGGG + Intergenic
923700289 1:236293722-236293744 ATGAGGACCCAGAGAGAAGATGG + Intergenic
923783697 1:237048047-237048069 CTGGGGTCCGAGAGGCAAGAGGG - Intronic
924238883 1:242022443-242022465 CTGGGGTCCTAGATGGAATTAGG - Intergenic
924248407 1:242107167-242107189 ATGGGGTCGTTCAAGGAAGATGG + Intronic
1063957781 10:11282269-11282291 ATGGGGACCGAGAGGGCAGAGGG + Intronic
1064920641 10:20513534-20513556 TTATGGTCCTAGAGGCAAGAAGG + Intergenic
1064920723 10:20514938-20514960 TTATGGTCCTAGAGGCAAGAAGG - Intergenic
1069530345 10:69213605-69213627 ATGGGATCCAAAAGAGAAGAAGG - Intergenic
1070513528 10:77182685-77182707 ATGGGGTCTACTAGGGAAGAAGG - Intronic
1071935924 10:90530597-90530619 ATGGGATCCTTGAGATAAGAGGG - Intergenic
1071967021 10:90861982-90862004 ATGAGTACCTAGAGGGAAGAAGG - Intergenic
1072205838 10:93204700-93204722 ATGGGGCCTGAGAGGGAAGCTGG + Intergenic
1073489217 10:103841620-103841642 ATGGGGTCAGATAGGGAAAAGGG - Intronic
1074707878 10:116151597-116151619 ATGGGAAAATAGAGGGAAGAGGG + Intronic
1076495933 10:130897963-130897985 CTGGGGTCCTAGTGGGCAGGGGG + Intergenic
1076911984 10:133394897-133394919 CTGGGGGCCGAGGGGGAAGAAGG + Intronic
1077268969 11:1666244-1666266 AGGGGGTCCTGGAGGGCAGGGGG - Intergenic
1077271633 11:1684600-1684622 AGGGGGTCCTGGAGGGCAGGGGG + Intergenic
1077271647 11:1684634-1684656 AGGGGGTCCAGGAGGGCAGAGGG + Intergenic
1077271681 11:1684712-1684734 AGGGGGTCCTGGAGGGCAGGGGG + Intergenic
1077271695 11:1684746-1684768 AGGGGGTCCAGGAGGGCAGAGGG + Intergenic
1077271723 11:1684807-1684829 AGGGGGTCCTGGAGGGCAGGGGG + Intergenic
1077271729 11:1684824-1684846 AGGGGGTCCCGGAGGGCAGAGGG + Intergenic
1077271744 11:1684858-1684880 AGGGGGTCCCGGAGGGCAGAGGG + Intergenic
1077271767 11:1684909-1684931 AGGGGGTCCAGGAGGGCAGAGGG + Intergenic
1077937689 11:6806419-6806441 GTGGGTTACTAGAGGGAGGAGGG - Intergenic
1078496051 11:11818110-11818132 ATGTGGTCCTGATGGGAAGATGG + Intergenic
1078513963 11:12007841-12007863 GTGGGGGCAGAGAGGGAAGATGG - Intronic
1082062101 11:47869711-47869733 ATGGTGTCCCAGAGGGAAAGTGG + Intergenic
1084470890 11:69358439-69358461 ACTGGGTCCTTGAGGGAATAGGG - Intronic
1085205018 11:74726494-74726516 ATGGGGTCCTGGACAGAGGAAGG + Intronic
1085646961 11:78230590-78230612 ATGTGCTCCTAGAAGGCAGAGGG + Intronic
1085875496 11:80402382-80402404 ATGAGCTCAGAGAGGGAAGAGGG - Intergenic
1086063474 11:82723516-82723538 ATGAGGTCCTAGAGGCAAGTGGG + Intergenic
1087308771 11:96515788-96515810 ATGGGATCCTAGAACCAAGAAGG - Intergenic
1087721371 11:101669620-101669642 GTGGTGTTCTAGAGGCAAGAAGG - Intronic
1089223432 11:116895123-116895145 ATGAGGTCAGAGAGGTAAGAGGG - Intronic
1089255705 11:117192805-117192827 ATGCGGTCCTGGAGGGAAGCAGG - Exonic
1089532110 11:119136907-119136929 GTGGGCTCCTGGAGGGAGGAGGG + Intergenic
1090022115 11:123137456-123137478 ACAGGGTCCCAGAGGGGAGATGG + Intronic
1090745798 11:129703982-129704004 ATGGGGCCTGAGAGGGGAGATGG - Intergenic
1091555351 12:1569341-1569363 GTGGGGTTGAAGAGGGAAGAAGG - Intronic
1091658861 12:2366459-2366481 ATTGGGTGCTGGAGGGAAGCAGG + Intronic
1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG + Intronic
1095576472 12:43745785-43745807 ATGGTGTCCTCCAGAGAAGAGGG - Intronic
1097203532 12:57300445-57300467 ATGGGGTTGAAGAGAGAAGAGGG - Intronic
1097283981 12:57863777-57863799 AAGGGATCTTGGAGGGAAGAAGG - Intergenic
1099054687 12:77824473-77824495 TTGGAGCCCTAGAAGGAAGAGGG + Intergenic
1099430141 12:82573499-82573521 ATGCGGTCCTACATGAAAGAAGG - Intergenic
1100278125 12:93091153-93091175 ATAGGGGCCTAGTGGCAAGAAGG - Intergenic
1100761537 12:97812604-97812626 CTGGAATGCTAGAGGGAAGATGG + Intergenic
1101616440 12:106342489-106342511 ATGGTGTTCTAGGAGGAAGAGGG + Intronic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1106628845 13:31448406-31448428 AAGGCTTCCTATAGGGAAGAAGG + Intergenic
1106670795 13:31903046-31903068 ATGTGGCTCTAGAGGGAGGAAGG + Intergenic
1109305059 13:60629434-60629456 CTAGGGTACTAGAAGGAAGATGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112205654 13:97321080-97321102 ATGGGATCCTAGTTGGAAGTAGG - Intronic
1112358722 13:98696933-98696955 GTGAGGACCTAGAGGGAAGGTGG + Intronic
1113374106 13:109748065-109748087 ATGGGGTGGTAGAAGGCAGAAGG + Intergenic
1114453259 14:22839800-22839822 ATGGGATCTTGGAGGGGAGATGG - Intronic
1116407942 14:44588284-44588306 ATGAGTGCCTACAGGGAAGAAGG + Intergenic
1117176045 14:53147868-53147890 ATGGAGTCCCAGGGGGTAGAAGG - Intronic
1117574186 14:57081693-57081715 ATGGGAACCAAGGGGGAAGAAGG - Intergenic
1118709969 14:68510888-68510910 ATGGCTTCCTTGAGGGAAAAGGG + Intronic
1119787945 14:77326892-77326914 ATGGGGGCCAACAGGTAAGAAGG + Exonic
1124161860 15:27277906-27277928 ATGTGGTCCCTGAGGGAAGTGGG - Intronic
1124786342 15:32684401-32684423 ACTGGATCCTAGAGGGAAGGTGG + Intronic
1125790362 15:42360995-42361017 CTAGGGTCCTGAAGGGAAGATGG + Intronic
1127028483 15:54834580-54834602 ATGGGGGAATAGATGGAAGAGGG - Intergenic
1127798166 15:62455733-62455755 ATGGAGTCCCAGAGGCAAAAGGG - Intronic
1130117345 15:81016568-81016590 ATGGGGTCATCCTGGGAAGAGGG + Intronic
1130253442 15:82315146-82315168 AGGGGGTCGCACAGGGAAGAAGG - Intergenic
1130458072 15:84134503-84134525 ATGGGGTCTTTAAGGGTAGAAGG - Intergenic
1130985789 15:88843615-88843637 ATGGCGTCGTAGCGGGATGAGGG - Exonic
1130985812 15:88843692-88843714 ATGGGGTCCTAGAGGGAAGAGGG + Intronic
1133022710 16:2973958-2973980 ATGGGGGGCTAGGGGGAAGGTGG - Intronic
1133148228 16:3806755-3806777 AGGGGGCCTTGGAGGGAAGATGG - Intronic
1134453015 16:14374813-14374835 TTGGGGTCATGGAGGGAAGAAGG + Intergenic
1135152583 16:20021926-20021948 AGGGGGTCCTACAGGGAAGACGG - Intergenic
1135954995 16:26949044-26949066 ATGGTATCCAAGAGGTAAGAAGG - Intergenic
1137790600 16:51171603-51171625 ATGGTGTTCTAGAGAGAATATGG - Intergenic
1138406894 16:56802951-56802973 AGGGGGTGGGAGAGGGAAGAAGG - Intronic
1138471396 16:57240934-57240956 ATAGGGTCCTAGAGAGAATGAGG + Intergenic
1138792988 16:59930245-59930267 ATGGTCTCCTAGAGAGAACAGGG - Intergenic
1139232953 16:65304239-65304261 TTGGAGTCTTAGATGGAAGAGGG + Intergenic
1139662436 16:68430205-68430227 GAGGGGGCATAGAGGGAAGAGGG - Intronic
1139752593 16:69118828-69118850 AGGTGGTCCTGGAGGGAAAATGG + Exonic
1140029506 16:71323850-71323872 ATGGGATCCTAGAATGAAAAAGG + Intergenic
1140981208 16:80111571-80111593 ATGGGGTAGAAGAGGGCAGAGGG - Intergenic
1141693191 16:85607829-85607851 GTGGGGGCCTCAAGGGAAGAAGG - Intergenic
1142278428 16:89135267-89135289 ATGGGCTCCTTGAGGGATGCTGG + Intronic
1142754343 17:2006978-2007000 ATGGGGTCCTGGAAAGATGAAGG + Intronic
1142964694 17:3573286-3573308 GGGTGGTCCTGGAGGGAAGAAGG - Intronic
1143449825 17:7029454-7029476 ATGGGGAGAAAGAGGGAAGAGGG - Exonic
1144845016 17:18212737-18212759 ATGGGGTCCTAGCGGGGTGAGGG - Intergenic
1145020109 17:19423507-19423529 AGGGTGTTCTAGAGGAAAGATGG - Intergenic
1146473345 17:33141654-33141676 AGGGGTTCCTAGAGGGATGGCGG + Intronic
1146666313 17:34706794-34706816 ACTGGATCCTACAGGGAAGAGGG - Intergenic
1148742028 17:49898363-49898385 CTGGGGTCCTACAGGGAGGGAGG + Intergenic
1150122434 17:62615432-62615454 ATGGGGTGGGGGAGGGAAGAAGG + Intronic
1151257916 17:72893764-72893786 ATAGGGTCCTAGGAAGAAGAGGG + Intronic
1152293224 17:79452618-79452640 ATGGGGTCACAGAGCGGAGAGGG + Intronic
1152595282 17:81234782-81234804 CTGGGCTCCTGCAGGGAAGATGG - Intronic
1154281228 18:13005021-13005043 TTGTGGTACTAGAGGCAAGAGGG + Intronic
1155150902 18:23122128-23122150 ATGGTGTCCCAGAGGGCAAAGGG + Intergenic
1155787985 18:29926116-29926138 ATGGAGTCTTAGAGGCAAGAGGG + Intergenic
1156213017 18:34967513-34967535 GTGGGCTCCTAGACGGAAGCTGG - Intergenic
1157505339 18:48222227-48222249 ATGCTTTCCTAGAGGCAAGAGGG - Intronic
1158047391 18:53172750-53172772 ATGAGGTCCTATAGGGAAAAAGG - Intronic
1159313152 18:66736502-66736524 TTGAGGTCCTAAAGGAAAGAAGG - Intergenic
1160589766 18:79936979-79937001 GTGGGGTCCTTGAGGGCAGAAGG + Intronic
1160774029 19:846597-846619 CTGTGGTCCTAGAGGGGAGTGGG - Intronic
1162256275 19:9492519-9492541 ATGGGTTCCTTGATGAAAGATGG - Intronic
1162891913 19:13739643-13739665 TTGGGTTCCTAGAGAGGAGAAGG - Intronic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1164834470 19:31348963-31348985 AATGGGTGCGAGAGGGAAGAGGG + Intronic
1165141747 19:33704000-33704022 CTGGGGTCCCAGAGGGAAGTCGG + Intronic
1165894893 19:39135790-39135812 ATGGGGTCACTGTGGGAAGATGG - Intronic
1165925152 19:39321639-39321661 TTAGGGTCCTTGAGGGTAGAAGG - Intergenic
1166433820 19:42749888-42749910 ATAGGGTCCTGGAGCCAAGATGG - Intronic
1166446668 19:42863668-42863690 ATAGGGTCCTGGAGCCAAGATGG - Intronic
1166670245 19:44705544-44705566 ATGGGGCAGTAGAGGGAAGGAGG - Intronic
1166840132 19:45692296-45692318 AACGCGTCCCAGAGGGAAGAGGG - Exonic
1167594897 19:50422445-50422467 ACGGGGTGCAGGAGGGAAGAGGG - Intronic
925197308 2:1936760-1936782 ATGGTGTCCTGCAGGGAAGCTGG + Intronic
925859110 2:8157825-8157847 CTGGGGTCCTGGAAGGGAGAGGG - Intergenic
926457099 2:13080407-13080429 ATGAGGACCTAGTGAGAAGATGG + Intergenic
927129554 2:20046934-20046956 ATGTTCTCCTGGAGGGAAGAGGG - Intronic
927953974 2:27194905-27194927 AGTGGCTCCTTGAGGGAAGAGGG - Intergenic
928369727 2:30732236-30732258 ATGGGGAACTACAGGGGAGAGGG + Intronic
929020739 2:37550187-37550209 ATGAGGTCCTAGAGGGATGGTGG - Intergenic
929261480 2:39871183-39871205 ATGTGGTCTTGGAGAGAAGATGG - Intergenic
929304173 2:40341058-40341080 ATGGAGTAGTAGAGAGAAGAGGG + Intronic
929441477 2:41968601-41968623 AATTTGTCCTAGAGGGAAGAGGG - Intergenic
929499955 2:42481816-42481838 ATAGGGTCCTGGAGGGATGCAGG - Intronic
929557868 2:42936753-42936775 CTGGGGTCCTTGAGGAATGAGGG + Intergenic
929696064 2:44116539-44116561 ATGCAGTCATAGAGGGAAAATGG + Intergenic
929834478 2:45382489-45382511 ATGGGGTAACAGAGGGAGGAAGG - Intergenic
929942249 2:46343188-46343210 ATGGGGTCGGCGGGGGAAGAAGG - Intronic
931514812 2:63043982-63044004 ATGAGGACCTAGAGGGAAACAGG - Intronic
932373528 2:71213434-71213456 AGAGGGTCCTTGAGGGACGAGGG + Intronic
932605452 2:73162868-73162890 GTGGGGCCAGAGAGGGAAGAAGG + Intergenic
934734811 2:96684730-96684752 ATAGGGTCAGAGAGAGAAGATGG + Intergenic
934852887 2:97712670-97712692 TTGGGGCACTAGAGGGGAGATGG + Intergenic
938549962 2:132370814-132370836 ATGGGGTGCTGGAAGGGAGATGG + Intergenic
941583564 2:167330124-167330146 TCAGGGTCCTAGAGTGAAGAAGG - Intergenic
942541994 2:177024044-177024066 AAAGGGTCCTAGAGGGTACATGG - Intergenic
942979592 2:182063847-182063869 ATGTGGTCCTAGAGAACAGACGG - Intronic
944201030 2:197107725-197107747 ATGTGGTCCTGGAGGACAGAGGG + Intronic
944362741 2:198877544-198877566 AGGGGATGCTAGAGGGAGGATGG - Intergenic
944982555 2:205138021-205138043 ATGGAGTCCGATAGGGAAGTGGG + Intronic
945046843 2:205789294-205789316 ATGGGGGCCTAGAAGGAAACAGG + Intronic
945139330 2:206667209-206667231 ATGAGGTCAGAGAGGGAAGGGGG - Intronic
946115951 2:217462388-217462410 TTGGGTTCCTTGAGGGAATATGG + Intronic
946975808 2:225148907-225148929 ATGGGGTCAGAGGGGGAAGAGGG - Intergenic
947635708 2:231679950-231679972 ATGGGATCCTATAGAAAAGAGGG - Intergenic
948130970 2:235600399-235600421 ATGGGGGTCTATAGGGCAGAGGG - Intronic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171871292 20:30528247-30528269 TTGGGATACTAGAGGGAAGGAGG - Intergenic
1172445486 20:34991046-34991068 ATGGGGTCCTGGAGGGGATCCGG + Exonic
1173176968 20:40771856-40771878 TGGGGGTCCTGGAGGGAGGAGGG - Intergenic
1173454695 20:43192580-43192602 ATGGGGTCAGAGGGGAAAGAGGG - Intergenic
1173872836 20:46352500-46352522 ATGGGACCCTAGCGGGATGATGG + Intronic
1173872847 20:46352539-46352561 ATGGGATCCTAGCGGGATGATGG + Intronic
1173872877 20:46352666-46352688 ATGGGATCCTAGTGGAATGATGG + Intronic
1173872888 20:46352708-46352730 ATGGGATCCTAGCGGGATGAAGG + Intronic
1175807613 20:61838473-61838495 ATGGGAGCCTTGAGGGAAGAAGG - Intronic
1178862320 21:36299695-36299717 AGGCGGTGCTAGAAGGAAGAGGG + Intergenic
1179875895 21:44267278-44267300 ACGGGCTCCTGGAGAGAAGATGG - Intergenic
1179951709 21:44712098-44712120 AGGGGGTCCTAGAGGCAGGTCGG + Intergenic
1180085617 21:45506798-45506820 AGGGAGTGCTAGAGGGAAGGTGG - Intronic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181151688 22:20888458-20888480 ATGGGGGGCTGGAGGGAAGCGGG - Exonic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1183269380 22:36851114-36851136 ATGGAGGCCGAGAGTGAAGAAGG - Intergenic
1184044707 22:41965647-41965669 CCTGGGTCCCAGAGGGAAGAGGG + Intergenic
1184730102 22:46367111-46367133 AAGGGGCCCTGGAGGGAGGAAGG + Exonic
1184917477 22:47580306-47580328 AGGGGGTGCAAGAGGAAAGAAGG - Intergenic
1185194381 22:49459703-49459725 AAGGGATTCGAGAGGGAAGAAGG + Intronic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
950213618 3:11142040-11142062 AAGGGGTCCTTGAGGGCAGAGGG - Intronic
951724609 3:25743312-25743334 TTGAGGTCAGAGAGGGAAGAGGG - Intronic
953038558 3:39234598-39234620 AGGGGGTCCTGAAGGGAGGAAGG + Intergenic
954659238 3:52218044-52218066 AAGGTGTCCTAAAGGGAAAAGGG + Intergenic
955059151 3:55481791-55481813 ATGGAACCCTAGAGGAAAGAAGG + Intronic
959367961 3:105487698-105487720 ATAGGGTCAGAGAGGGTAGAAGG + Intronic
961647791 3:128401613-128401635 ATGGCGTCAGAGAGGGAGGAGGG + Intronic
963077434 3:141360229-141360251 GTGGGGTCCCAGAGCTAAGATGG - Intronic
963622490 3:147629091-147629113 ATGGCCTTCTAGATGGAAGAGGG - Intergenic
963641059 3:147862318-147862340 AAGGGGTCCCAGATGGAGGAGGG + Intergenic
963673870 3:148284204-148284226 ATGAGGACATAGAGAGAAGATGG - Intergenic
964525519 3:157612357-157612379 ATGGCATCCCAGAGGGAAAAAGG + Intronic
964744690 3:160001396-160001418 GTGGGGTCATTGAGGGGAGAGGG - Intergenic
966424290 3:179764470-179764492 TTGTGGCCCTAGAGGAAAGAGGG + Intronic
969329005 4:6462095-6462117 AAGGGGTCCTGGAGGAGAGAGGG + Intronic
969710434 4:8840238-8840260 ATGGGGTCAGAGAGTGACGAGGG + Intergenic
969953609 4:10865574-10865596 ATGGAGCCCTAGAGTAAAGAGGG - Intergenic
971156368 4:24087573-24087595 ATGAGGACTTGGAGGGAAGATGG - Intergenic
972248050 4:37267086-37267108 ATGTGGTCATAAAGGGAAGAAGG + Intronic
981669437 4:147270465-147270487 TTGGGGACTAAGAGGGAAGAGGG - Intergenic
981705442 4:147654635-147654657 ATGGGGGGCTAGATGGAGGATGG - Intronic
984767201 4:183408801-183408823 ATGTGATCCTAGAGACAAGAAGG - Intergenic
985609909 5:881644-881666 TTGGGGTTCAAGGGGGAAGAGGG + Intronic
989011644 5:36877658-36877680 ATGGGGTCACAGGGGGAAGAAGG - Intronic
990831891 5:59968416-59968438 ATGGACTACTAGAGGGTAGAGGG + Intronic
993564029 5:89450405-89450427 GTGGGGAGCTAGAGGGATGAGGG + Intergenic
995679537 5:114701502-114701524 ATGGGGTAGAAGAGGGAAGGTGG - Intergenic
995856778 5:116600871-116600893 CTGGGGTCCCAGAGGAAAGCTGG + Intergenic
996401982 5:123072595-123072617 ATGGTAGCCTAGAGAGAAGAGGG - Intergenic
996857583 5:128027059-128027081 ATGTGGTCCTACAGGGAAAATGG + Intergenic
997174446 5:131760076-131760098 GTGGACTACTAGAGGGAAGAGGG + Intronic
997742051 5:136264314-136264336 CTGGGGTCCAAGTGGGAAAATGG + Intronic
998170833 5:139871141-139871163 ATGGGGTCCTGTAGGGCAGAAGG + Intronic
998511692 5:142719058-142719080 ATGGGCTCCCAGATGGAGGAGGG + Intergenic
999697629 5:154200387-154200409 AGGGGCTCCTGGAGGGAAGGGGG + Intronic
1000817011 5:165936083-165936105 ATGGGACCCCAGAGGAAAGAAGG - Intergenic
1001679517 5:173545918-173545940 ATGAGCTCCTTGTGGGAAGAGGG - Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002454608 5:179338966-179338988 ATGGGGTCATCCAGGGAAGGGGG + Intronic
1003269355 6:4593545-4593567 ATGGGGTCTTAGTGGGGAAAAGG - Intergenic
1007089041 6:39170465-39170487 ATGGACTCCTAGAGGGAATCTGG + Intergenic
1010259041 6:73794445-73794467 ATGGGGTCCTGTAGAGAAGGAGG + Intronic
1010825611 6:80469761-80469783 ATTGGGGCCTAGAGAGGAGAAGG - Intergenic
1012167305 6:95973387-95973409 ATGAGTTGCCAGAGGGAAGAAGG + Intergenic
1013476109 6:110508791-110508813 ATGGGGAGCTAGAAGGGAGATGG - Intergenic
1017056666 6:150443000-150443022 ATGGTGTCCAAGAGGGAGTATGG + Intergenic
1017544849 6:155439425-155439447 ATGGGGTCCTAGAGGTCAAATGG + Intronic
1017866259 6:158445921-158445943 GTGGTTTCCTAGAGAGAAGAGGG + Intronic
1018813429 6:167314283-167314305 ATGGGGTCCTTGAGGCAGGGAGG - Intronic
1020648088 7:10840659-10840681 TTGGGGTCCAGGAGGGAAGTTGG + Intergenic
1020976626 7:15014455-15014477 ATGAGGTCCTAAAGGGAAGTGGG + Intergenic
1023864924 7:44234025-44234047 GTGGGGTCCTGGTGGGGAGAGGG + Intronic
1026482456 7:70790406-70790428 ATGGGGTCCCAGTGGAAAGAAGG - Exonic
1026857183 7:73762563-73762585 AAGGGCTCCAAGAGGGAAGGGGG - Intergenic
1027719664 7:81724277-81724299 ATAGAGTTGTAGAGGGAAGAGGG - Intronic
1029514672 7:101017826-101017848 AAGGGGTCCCAGGGGGAGGAAGG - Intronic
1032574060 7:133033861-133033883 CTGATGTCCTAGAGGGATGAGGG + Intronic
1035130689 7:156650451-156650473 GTGGGGTTCTAAAGGCAAGATGG + Intronic
1038007401 8:23444403-23444425 GTGGGTTCCTGGAGGGGAGAGGG - Intronic
1038426437 8:27467195-27467217 TTGGGGTCCTGGGGGGATGAGGG - Intronic
1038819225 8:30936996-30937018 AAAGAGTCCTAAAGGGAAGAGGG + Intergenic
1039669975 8:39584770-39584792 ATGGGATCCCAGAAGGGAGAGGG - Intronic
1040689877 8:49923581-49923603 ATTGAGTCCTAGGAGGAAGATGG + Intronic
1041048832 8:53913616-53913638 AGGCAGTCATAGAGGGAAGAAGG + Intronic
1042803967 8:72751892-72751914 ATGGAGGCCAGGAGGGAAGAAGG + Intronic
1043393329 8:79812283-79812305 ATTGGGTCCTGGAAGGGAGAAGG + Intergenic
1044417671 8:91954460-91954482 AAGGGGTCAGAAAGGGAAGATGG - Intergenic
1044962541 8:97544909-97544931 ATGGGGTCAAAGAGGAAGGAGGG + Intergenic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045342592 8:101267911-101267933 ATGCAGTCCTAGAGGGATGCAGG - Intergenic
1046791449 8:118326601-118326623 TTGGGGGGCTAGAGGGAGGATGG - Intronic
1048285812 8:133140821-133140843 ATGAGGCCAAAGAGGGAAGAAGG - Intergenic
1048400975 8:134070360-134070382 ATGGGGTACTAGAGGTGATAGGG - Intergenic
1049609900 8:143550069-143550091 TTGCGGACCCAGAGGGAAGAAGG - Intergenic
1049778341 8:144416375-144416397 CTGGGGTCCTGGGGAGAAGAGGG + Intronic
1050241055 9:3635831-3635853 ATGGGGTGCTCTTGGGAAGAGGG + Intergenic
1051693354 9:19741285-19741307 AAGGGGAGCTAGAGGGAAGTGGG + Intronic
1052104868 9:24500903-24500925 AATGGGTCATACAGGGAAGAAGG - Intergenic
1052231940 9:26164710-26164732 ATGGGGAACTAGAGAGGAGAGGG - Intergenic
1053280527 9:36817513-36817535 ATGGGGTCCTGGGGGGCAGTAGG + Intergenic
1053591671 9:39520904-39520926 GTGGGGTCATAGAGAGAACAGGG - Intergenic
1054451246 9:65404537-65404559 ATAGGGTCCTGGAGGGCAGCAGG - Intergenic
1055961936 9:81828954-81828976 AGGGGCTCCTGGAGGAAAGAAGG - Intergenic
1057117330 9:92538072-92538094 ATGGGTTCCTAGAGGTGAAATGG - Intronic
1059212766 9:112529403-112529425 ATGGGGTCCTGGACAGAAAAAGG - Intronic
1059694862 9:116721435-116721457 ATGGAGCCCCAGTGGGAAGAAGG + Intronic
1061369817 9:130191948-130191970 ATGGGGGGCTGGAGGGCAGAAGG + Intronic
1061657613 9:132104804-132104826 CTGGGTTCCTAGAGGTAGGAGGG + Intergenic
1062006642 9:134241742-134241764 ATGGGGTCCTGGACAGAAAAGGG + Intergenic
1062218122 9:135399993-135400015 GTGGGGTCTGAGAGGGAGGAAGG + Intergenic
1187929748 X:24283227-24283249 AGGGAGACCTAGAGGGAAGAAGG - Intergenic
1189432510 X:40960118-40960140 AGGGGGTGTTAGAGGGAAGGGGG + Intergenic
1189794773 X:44635236-44635258 AGGTGGTCCTGGAGGGAAAAAGG - Intergenic
1192035590 X:67559486-67559508 ATTGGGGCCTAGAGGGACGGAGG - Intronic
1192190616 X:68989167-68989189 ATGGGAACCAAGAGGGAAAAAGG + Intergenic
1192491380 X:71579399-71579421 ATGGGGGCGTTGAGGGAAGTGGG + Intronic
1194467351 X:94250061-94250083 TTGGGGTCCTATGGGAAAGAGGG - Intergenic
1196003790 X:110813890-110813912 ATGAGGTCAGAGAGGGAACAGGG + Intergenic
1197275432 X:124473732-124473754 ATGGGGGCCTGGAGGGAATGGGG - Intronic
1197951112 X:131898256-131898278 ATGGGGTCTCATGGGGAAGAAGG - Intergenic
1198330034 X:135613922-135613944 ATAGTGTCCTGCAGGGAAGAAGG + Intergenic
1198336885 X:135675072-135675094 ATAGCGTCCTGCAGGGAAGAAGG - Intergenic
1198337124 X:135677395-135677417 ATGGTGTCATAAAGGGAAGAAGG - Intergenic
1198362702 X:135911383-135911405 ATAGTGTCCTGCAGGGAAGAAGG + Intronic
1198962305 X:142195541-142195563 ATGGGATCCCAGAGGCATGAGGG + Intergenic
1200910060 Y:8523971-8523993 ATGGGGAGCCAGAAGGAAGATGG - Intergenic
1201265374 Y:12201343-12201365 AGGGGTTCCTAGCAGGAAGATGG - Intergenic
1202111115 Y:21421701-21421723 ATGGGGACCCAGAAGGCAGATGG + Intergenic