ID: 1130990310

View in Genome Browser
Species Human (GRCh38)
Location 15:88872045-88872067
Sequence CCAGCGGAAGTCCCCTTCGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 34}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130990310_1130990317 12 Left 1130990310 15:88872045-88872067 CCATCGAAGGGGACTTCCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 34
Right 1130990317 15:88872080-88872102 CCCATGGTGAGTTCTGCTGTAGG 0: 1
1: 0
2: 1
3: 13
4: 161
1130990310_1130990321 30 Left 1130990310 15:88872045-88872067 CCATCGAAGGGGACTTCCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 34
Right 1130990321 15:88872098-88872120 GTAGGCACAGCTGGTGGCCCAGG 0: 1
1: 0
2: 3
3: 33
4: 284
1130990310_1130990320 24 Left 1130990310 15:88872045-88872067 CCATCGAAGGGGACTTCCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 34
Right 1130990320 15:88872092-88872114 TCTGCTGTAGGCACAGCTGGTGG 0: 1
1: 0
2: 4
3: 27
4: 255
1130990310_1130990319 21 Left 1130990310 15:88872045-88872067 CCATCGAAGGGGACTTCCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 34
Right 1130990319 15:88872089-88872111 AGTTCTGCTGTAGGCACAGCTGG 0: 1
1: 0
2: 1
3: 20
4: 256
1130990310_1130990314 -4 Left 1130990310 15:88872045-88872067 CCATCGAAGGGGACTTCCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 34
Right 1130990314 15:88872064-88872086 CTGGTCAGATGGACACCCCATGG 0: 1
1: 0
2: 0
3: 9
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130990310 Original CRISPR CCAGCGGAAGTCCCCTTCGA TGG (reversed) Exonic