ID: 1130990435

View in Genome Browser
Species Human (GRCh38)
Location 15:88872730-88872752
Sequence GATAGCAGCACAAAAACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130990435_1130990438 11 Left 1130990435 15:88872730-88872752 CCAGCAGTTTTTGTGCTGCTATC 0: 1
1: 0
2: 0
3: 14
4: 151
Right 1130990438 15:88872764-88872786 AAGTTGGTGCTAAAAGAGAAAGG 0: 1
1: 1
2: 3
3: 30
4: 268
1130990435_1130990439 25 Left 1130990435 15:88872730-88872752 CCAGCAGTTTTTGTGCTGCTATC 0: 1
1: 0
2: 0
3: 14
4: 151
Right 1130990439 15:88872778-88872800 AGAGAAAGGAGATGATGAAGAGG 0: 1
1: 0
2: 14
3: 128
4: 1512
1130990435_1130990436 -5 Left 1130990435 15:88872730-88872752 CCAGCAGTTTTTGTGCTGCTATC 0: 1
1: 0
2: 0
3: 14
4: 151
Right 1130990436 15:88872748-88872770 CTATCAGATGAGCCTGAAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130990435 Original CRISPR GATAGCAGCACAAAAACTGC TGG (reversed) Intronic
904403898 1:30274027-30274049 GATAGCAGGACAAGAACTCAGGG - Intergenic
905485638 1:38293886-38293908 TATAGCAGCACAAAGACAGCTGG - Intergenic
905684702 1:39900581-39900603 GGCAGCAGCAAAAAAACTTCAGG + Intronic
909295848 1:73947796-73947818 TATATCAGCACAAAACCTACTGG + Intergenic
913547845 1:119887049-119887071 GAGAGCAGCAAAAAATCTGCCGG - Intergenic
913595997 1:120377746-120377768 GTTAGCAGCTCCAGAACTGCTGG - Intergenic
914091282 1:144501230-144501252 GTTAGCAGCTCCAGAACTGCTGG + Intergenic
914307321 1:146432969-146432991 GTTAGCAGCTCCAGAACTGCTGG - Intergenic
914594785 1:149140162-149140184 GTTAGCAGCTCCAGAACTGCTGG + Intergenic
918493658 1:185110135-185110157 TATAGCAGCAGAAACATTGCTGG - Intergenic
919281314 1:195493350-195493372 GACAGCAGCACAATAATAGCGGG - Intergenic
920838864 1:209537050-209537072 GACCTCACCACAAAAACTGCTGG - Intergenic
921686360 1:218093467-218093489 GGTGGAAGCAAAAAAACTGCTGG + Intergenic
923874925 1:238036817-238036839 GACAGCAGCACAACAATAGCGGG + Intergenic
1064443763 10:15375459-15375481 GATAGCTTCAAAAAAAATGCTGG - Intergenic
1065110787 10:22437677-22437699 CAGAGCAGCAGAAAAACCGCAGG - Intronic
1072129593 10:92481088-92481110 AATAGCAGCTCAAAAACTTAAGG + Intronic
1072714446 10:97740683-97740705 CCCAGCAGCACAGAAACTGCAGG - Intronic
1072885542 10:99269487-99269509 GATAGCAACACAATAATAGCAGG + Intergenic
1081416760 11:42824528-42824550 GATAGATGCACAGAAACTTCAGG - Intergenic
1083350749 11:62027202-62027224 GATAGAAGCAAAAGAACAGCAGG - Intergenic
1083566259 11:63719571-63719593 GACTGCATCACAAAAACTACAGG + Exonic
1083816276 11:65134175-65134197 CAGAGCACCACAAAAACAGCGGG + Intronic
1085753164 11:79180044-79180066 AATAGCACCATTAAAACTGCAGG - Intronic
1086431439 11:86740557-86740579 GATAACAGCACACTAACTGAAGG + Intergenic
1089836156 11:121372586-121372608 AAATGAAGCACAAAAACTGCAGG + Intergenic
1090991076 11:131817525-131817547 GATAGCAGCAGTGAATCTGCTGG - Intronic
1092615539 12:10212871-10212893 GCTGGGAGCACAAAAACAGCTGG - Exonic
1093290896 12:17320627-17320649 GATGGCAACACAATAATTGCAGG - Intergenic
1093510918 12:19927272-19927294 CATAGAAGGACAAATACTGCAGG - Intergenic
1095784694 12:46096690-46096712 GATAGCAACACAATAACAGTGGG + Intergenic
1097545358 12:60993500-60993522 GATAGCATAACAACAAATGCAGG + Intergenic
1099124556 12:78737006-78737028 GGCAGCAGCACAAAAATTGTGGG - Intergenic
1099452582 12:82825289-82825311 TATAACAGGACAAAAACTGTTGG + Intronic
1100182520 12:92100666-92100688 AATAGCAGCAAATAAACTGTGGG + Intronic
1102557580 12:113737782-113737804 GATAGCAACTCCAAAACTGTAGG + Intergenic
1103250219 12:119493382-119493404 GCTTGCAGCACAGTAACTGCCGG - Intronic
1103453731 12:121048550-121048572 CAGAGCAGCACAAAGACTACAGG - Intergenic
1103995296 12:124825789-124825811 GACAGAAGGACAAATACTGCAGG + Intronic
1106392029 13:29344256-29344278 GATGGCAGCACAATAACAGCGGG - Intronic
1108902280 13:55426355-55426377 GATAGCAGCACAATAATAGTGGG + Intergenic
1109632177 13:65064345-65064367 TATAGCAGCACAAAATCAGTGGG - Intergenic
1111922642 13:94428535-94428557 AATAGGTGCACAAATACTGCAGG + Intergenic
1111949007 13:94695035-94695057 GATAGGAAAACAAAAACTCCAGG + Intergenic
1114405093 14:22449147-22449169 GAGACCTGTACAAAAACTGCAGG + Intergenic
1115343451 14:32317208-32317230 TATAGCAGCTCAAATACAGCTGG + Intergenic
1116407021 14:44579007-44579029 GATACCAGCTCAAACACAGCAGG + Intergenic
1116591611 14:46783057-46783079 GATAGCCACACAATAACTGTAGG + Intergenic
1117318915 14:54602017-54602039 GAAAGCAGGACAGAAACAGCAGG + Intronic
1117411155 14:55452348-55452370 GATAACAGCACATAAACTCCTGG + Intronic
1125473781 15:40030146-40030168 GAGAGAAGCATCAAAACTGCTGG + Intronic
1126867140 15:52948816-52948838 GAAATAAGAACAAAAACTGCAGG - Intergenic
1126908666 15:53395853-53395875 CATAGCAGCACTGAAACAGCAGG + Intergenic
1127290576 15:57567056-57567078 GATATCAGTACGAAAACTGTGGG - Intergenic
1129629233 15:77239363-77239385 TACAGTAGCAGAAAAACTGCAGG + Intronic
1130990435 15:88872730-88872752 GATAGCAGCACAAAAACTGCTGG - Intronic
1131436284 15:92425359-92425381 GAACACAGCACATAAACTGCAGG + Intronic
1133142475 16:3757343-3757365 CATAGCAGCACAAAGTCTGTGGG + Exonic
1133900001 16:9965187-9965209 GCTGGCAGAACAAAGACTGCAGG + Intronic
1134145624 16:11758915-11758937 GAAAGCAGTAAAGAAACTGCAGG + Intronic
1136095390 16:27951984-27952006 GATTGCTTCACAAAAATTGCTGG + Intronic
1139186503 16:64811979-64812001 GAGAGCAGCAAAAACAGTGCAGG - Intergenic
1139747498 16:69086606-69086628 AATAAAAGCACAAAAACGGCCGG + Intergenic
1141087536 16:81107637-81107659 GATATGAGCACACAGACTGCAGG - Intergenic
1142041686 16:87898254-87898276 GAAAGCAGCCCAGAAGCTGCAGG + Intronic
1143831585 17:9656271-9656293 GATGACAGCACACAAACAGCCGG - Intronic
1144139446 17:12334453-12334475 GATAGCAACACAATAACAGTGGG - Intergenic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1159014958 18:63093848-63093870 TATAGCAGCTGAGAAACTGCCGG - Intergenic
1164021162 19:21307243-21307265 GACCCCAGCACAGAAACTGCAGG + Intronic
1164527909 19:29025426-29025448 GACAGCAACACAAATACTGTAGG - Intergenic
925604680 2:5647093-5647115 GTTAGCAGCTCCAGAACTGCTGG - Intergenic
930721499 2:54642263-54642285 GAGAGCCGCACAAAGGCTGCTGG - Intronic
931177358 2:59867515-59867537 GATAGCAGCACATCATCTCCAGG - Intergenic
931343610 2:61426250-61426272 GGTACCAGCACAAACACAGCAGG + Intronic
933143570 2:78823358-78823380 AATAGCAGCACTAAAAGTGTTGG + Intergenic
935810010 2:106788452-106788474 GACAGAAGCACAAAAATTGATGG - Intergenic
937665735 2:124484854-124484876 GACAGCAGCCCAAGAACTCCAGG + Intronic
939488845 2:142852246-142852268 GATAGCAGCAGAAAAACTAGTGG + Intergenic
939626665 2:144485403-144485425 TATAGAAGCAAAAAATCTGCAGG + Intronic
941004413 2:160233090-160233112 GACAGCAGAAAAAAAAATGCAGG + Intronic
941540273 2:166773500-166773522 TATAGCAGCACAAAAATTATGGG - Intergenic
942286101 2:174417755-174417777 GAGAAGAGCACAAACACTGCTGG - Intronic
942937092 2:181570569-181570591 AATAGCATCAGAAAAACTTCCGG - Intronic
943257226 2:185611295-185611317 GACAGCAGCAGCAAAACAGCTGG + Intergenic
945722210 2:213431634-213431656 GATAGCAACACAATAAGTGCAGG + Intronic
949055074 2:241923206-241923228 GTTAGCTGCACAGAACCTGCAGG - Intergenic
949055081 2:241923257-241923279 GTTAGCTGCACAGAACCTGCGGG - Intergenic
949055089 2:241923308-241923330 GTTAGCTGCACAGAACCTGCGGG - Intergenic
949055104 2:241923410-241923432 GTTAGCTGCACAGAACCTGCGGG - Intergenic
1171242080 20:23579200-23579222 GATAGCAACACAATAACAGTGGG - Intergenic
1176742132 21:10614558-10614580 CCTACCAGCACAAAAACAGCAGG - Intergenic
1178412302 21:32375135-32375157 TACAGCAGCAGAAAAGCTGCTGG - Intronic
1178701457 21:34836692-34836714 GAAATGAGCACAAAACCTGCCGG - Intronic
1182768819 22:32778810-32778832 GAAAGCAACACACAAACTCCAGG + Intronic
1184080184 22:42213798-42213820 GATAGCTGCACAAATTCTGAAGG - Exonic
949737040 3:7185367-7185389 AATAGGAGCACAAGAACTTCTGG - Intronic
950292837 3:11800699-11800721 GATAGCAACACAATAACAGTGGG + Intronic
950678053 3:14566417-14566439 GATGGTAGCTCAAGAACTGCAGG + Intergenic
957663957 3:83199100-83199122 CATAGCATCATGAAAACTGCTGG + Intergenic
958778733 3:98516193-98516215 GAAAACAGCACTAATACTGCTGG + Exonic
958832053 3:99101105-99101127 GAGAGAAGCACAAAGACAGCAGG - Intergenic
960490494 3:118312117-118312139 GATAGCAGCAAAAAAAACACTGG - Intergenic
961985648 3:131130515-131130537 GATATCAGCAGAAAAACGTCAGG + Intronic
967187402 3:186956557-186956579 GACAGAAGCAGAAAAAGTGCTGG - Intronic
967681291 3:192367015-192367037 GAAAGAAGCAGAAAAACTACAGG + Intronic
973342848 4:49023952-49023974 GATAGCAGCACAGTAACAGTGGG - Intronic
976695568 4:87916745-87916767 GATAGCAGAACCCACACTGCTGG - Intergenic
977423494 4:96834655-96834677 GAGAGCAGCAAAAAGACTGCAGG + Intergenic
977767827 4:100821438-100821460 GATCTCAACAAAAAAACTGCAGG + Intronic
978354662 4:107858660-107858682 GATAGCAGCAGCAAAGCTGCAGG - Intronic
981094552 4:140764855-140764877 GATAGAAGCAAAAGAACAGCAGG + Intergenic
986173592 5:5333255-5333277 GATAGGAGGAAAAAAGCTGCTGG + Intergenic
986492972 5:8311459-8311481 GATTTCAGGACAAAAACTGTAGG + Intergenic
986906260 5:12497038-12497060 CATAGAAACACAAATACTGCAGG + Intergenic
989579308 5:43017248-43017270 GATAGTAGTTCAAAAACAGCCGG - Intergenic
991276028 5:64847419-64847441 GATTGCAGCACAATAACAACAGG + Intronic
995162685 5:109000021-109000043 GAAAGAATCAAAAAAACTGCTGG - Intronic
995699137 5:114914455-114914477 GATAGCAACACAATAACAGTGGG + Intergenic
996355321 5:122589771-122589793 TTTAGCAGCACACAAACTGTAGG - Intergenic
998409546 5:141899113-141899135 GATAACACCACAATAAATGCAGG + Intergenic
998760438 5:145426175-145426197 GAAAGCAGCAAAAACCCTGCAGG - Intergenic
1003029205 6:2587184-2587206 GATAGCAACACAATAACAGTGGG - Intergenic
1004767969 6:18752862-18752884 GAGAGCAGCAAAATAAATGCGGG - Intergenic
1005017664 6:21389705-21389727 GATAGCAGCATAAAACATACAGG + Intergenic
1005105648 6:22221713-22221735 TATATCAGCTCAAAAACTGAAGG + Intergenic
1005645157 6:27831090-27831112 GATAGCAGCACAAACTCAGCAGG + Intergenic
1006873858 6:37278415-37278437 TAGAGCAGCACATAAACTACTGG - Intronic
1010151530 6:72738312-72738334 GAAAGCAGCCCAAGAACTTCTGG - Intronic
1011154701 6:84317304-84317326 GATAATAGCACAAAAGCTGGTGG - Intergenic
1011262110 6:85480612-85480634 GAGCACAGCACAGAAACTGCTGG - Intronic
1012609500 6:101198840-101198862 GGTAGCAACAAAACAACTGCAGG + Intergenic
1014604121 6:123450631-123450653 GATAGCAACACAAAAATAGTGGG + Intronic
1018726789 6:166618806-166618828 GACAGCAGAACAACAACTGATGG - Intronic
1019663776 7:2241296-2241318 GATAGCAAAACAAAAATGGCCGG - Intronic
1025629667 7:63259395-63259417 GGCAGCAGCACAAAAAGTGAGGG + Intergenic
1027874633 7:83752965-83752987 TATAGCAGCACAAAAATTTCAGG + Intergenic
1028665560 7:93339693-93339715 GAAAGTAGTACATAAACTGCAGG + Intronic
1030652565 7:112131361-112131383 GATGCCAACACAAAAACTCCAGG + Intronic
1030791683 7:113738074-113738096 CATTGTAGCACAAAAGCTGCAGG + Intergenic
1034484016 7:151345860-151345882 GAGAGCATCAAAAAAACTGGGGG - Intronic
1037610517 8:20472439-20472461 GATACCAGCAGAAACACTGCTGG + Intergenic
1041810947 8:61909749-61909771 GATAGCATGACTAACACTGCAGG - Intergenic
1048232965 8:132661790-132661812 CATGGCATCACAAAAACTCCAGG - Intronic
1050843530 9:10184676-10184698 GAAAGCAGCAAAGAAACTGGGGG - Intronic
1051827005 9:21232580-21232602 GATAGCAGCCCACACCCTGCCGG - Intronic
1052499144 9:29267011-29267033 GACAGCAGCACAAAAATTGTCGG + Intergenic
1056091393 9:83208950-83208972 GAGAGCTGCACAAGAACTTCTGG + Intergenic
1057638023 9:96788855-96788877 GGTAGGAGCTGAAAAACTGCAGG + Intergenic
1060366352 9:123019249-123019271 GAAAGCATCATAAAAACTGTTGG + Intronic
1062233252 9:135494973-135494995 GAGATCTGCACAAACACTGCGGG - Intergenic
1062719068 9:138025512-138025534 GATGGTTGCACAAAAGCTGCTGG + Intronic
1189599936 X:42613394-42613416 GATAGCAGCACAATAACAGTGGG - Intergenic
1194040096 X:88930082-88930104 GATAGCAGCACAATAATAGTGGG - Intergenic
1194157125 X:90404755-90404777 GATCTCAGCACAGAAATTGCAGG - Intergenic
1194247517 X:91534428-91534450 GATAGCAGCCCAAACACAGTAGG - Intergenic
1196240292 X:113336221-113336243 GATTGGAGCACAGAAACTGCAGG + Intergenic
1197067108 X:122246502-122246524 TGAAGCAGCATAAAAACTGCTGG + Intergenic
1197848288 X:130828459-130828481 GATAGGAAAACAAAAACTTCTGG + Intronic
1197899192 X:131351118-131351140 AATAGCAACAAAAAACCTGCTGG - Intronic
1199860265 X:151795109-151795131 GAAATGAGCACAAAAACTGTGGG - Intergenic
1200243662 X:154511381-154511403 GACACCAGCAGAAACACTGCCGG + Intronic
1200566540 Y:4775961-4775983 GATAGCAGCCCAAACACAGTAGG - Intergenic
1201961237 Y:19682605-19682627 GTTAGCAGAACAAAGACTGTAGG - Intergenic