ID: 1130990887

View in Genome Browser
Species Human (GRCh38)
Location 15:88875047-88875069
Sequence GCCGGCTTACCCTCGGCAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 51}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130990887_1130990896 13 Left 1130990887 15:88875047-88875069 CCTCCTGCCGAGGGTAAGCCGGC 0: 1
1: 0
2: 1
3: 4
4: 51
Right 1130990896 15:88875083-88875105 CAGAGGGACCTCCGCTGCCTGGG 0: 1
1: 0
2: 0
3: 16
4: 269
1130990887_1130990892 -4 Left 1130990887 15:88875047-88875069 CCTCCTGCCGAGGGTAAGCCGGC 0: 1
1: 0
2: 1
3: 4
4: 51
Right 1130990892 15:88875066-88875088 CGGCAGGAGAGAGCCATCAGAGG 0: 1
1: 0
2: 2
3: 14
4: 228
1130990887_1130990897 19 Left 1130990887 15:88875047-88875069 CCTCCTGCCGAGGGTAAGCCGGC 0: 1
1: 0
2: 1
3: 4
4: 51
Right 1130990897 15:88875089-88875111 GACCTCCGCTGCCTGGGAGTTGG 0: 1
1: 0
2: 0
3: 17
4: 172
1130990887_1130990895 12 Left 1130990887 15:88875047-88875069 CCTCCTGCCGAGGGTAAGCCGGC 0: 1
1: 0
2: 1
3: 4
4: 51
Right 1130990895 15:88875082-88875104 TCAGAGGGACCTCCGCTGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 316
1130990887_1130990898 20 Left 1130990887 15:88875047-88875069 CCTCCTGCCGAGGGTAAGCCGGC 0: 1
1: 0
2: 1
3: 4
4: 51
Right 1130990898 15:88875090-88875112 ACCTCCGCTGCCTGGGAGTTGGG 0: 1
1: 0
2: 0
3: 10
4: 169
1130990887_1130990893 -3 Left 1130990887 15:88875047-88875069 CCTCCTGCCGAGGGTAAGCCGGC 0: 1
1: 0
2: 1
3: 4
4: 51
Right 1130990893 15:88875067-88875089 GGCAGGAGAGAGCCATCAGAGGG 0: 1
1: 0
2: 2
3: 53
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130990887 Original CRISPR GCCGGCTTACCCTCGGCAGG AGG (reversed) Exonic