ID: 1130990890

View in Genome Browser
Species Human (GRCh38)
Location 15:88875054-88875076
Sequence CTCTCCTGCCGGCTTACCCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 163}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130990890_1130990903 26 Left 1130990890 15:88875054-88875076 CCGAGGGTAAGCCGGCAGGAGAG 0: 1
1: 0
2: 0
3: 9
4: 163
Right 1130990903 15:88875103-88875125 GGGAGTTGGGTTCCCTCCAAGGG 0: 1
1: 0
2: 1
3: 9
4: 121
1130990890_1130990893 -10 Left 1130990890 15:88875054-88875076 CCGAGGGTAAGCCGGCAGGAGAG 0: 1
1: 0
2: 0
3: 9
4: 163
Right 1130990893 15:88875067-88875089 GGCAGGAGAGAGCCATCAGAGGG 0: 1
1: 0
2: 2
3: 53
4: 425
1130990890_1130990902 25 Left 1130990890 15:88875054-88875076 CCGAGGGTAAGCCGGCAGGAGAG 0: 1
1: 0
2: 0
3: 9
4: 163
Right 1130990902 15:88875102-88875124 TGGGAGTTGGGTTCCCTCCAAGG 0: 1
1: 0
2: 1
3: 24
4: 148
1130990890_1130990895 5 Left 1130990890 15:88875054-88875076 CCGAGGGTAAGCCGGCAGGAGAG 0: 1
1: 0
2: 0
3: 9
4: 163
Right 1130990895 15:88875082-88875104 TCAGAGGGACCTCCGCTGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 316
1130990890_1130990896 6 Left 1130990890 15:88875054-88875076 CCGAGGGTAAGCCGGCAGGAGAG 0: 1
1: 0
2: 0
3: 9
4: 163
Right 1130990896 15:88875083-88875105 CAGAGGGACCTCCGCTGCCTGGG 0: 1
1: 0
2: 0
3: 16
4: 269
1130990890_1130990898 13 Left 1130990890 15:88875054-88875076 CCGAGGGTAAGCCGGCAGGAGAG 0: 1
1: 0
2: 0
3: 9
4: 163
Right 1130990898 15:88875090-88875112 ACCTCCGCTGCCTGGGAGTTGGG 0: 1
1: 0
2: 0
3: 10
4: 169
1130990890_1130990897 12 Left 1130990890 15:88875054-88875076 CCGAGGGTAAGCCGGCAGGAGAG 0: 1
1: 0
2: 0
3: 9
4: 163
Right 1130990897 15:88875089-88875111 GACCTCCGCTGCCTGGGAGTTGG 0: 1
1: 0
2: 0
3: 17
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130990890 Original CRISPR CTCTCCTGCCGGCTTACCCT CGG (reversed) Exonic