ID: 1130990891

View in Genome Browser
Species Human (GRCh38)
Location 15:88875065-88875087
Sequence CTCTGATGGCTCTCTCCTGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 240}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130990891_1130990903 15 Left 1130990891 15:88875065-88875087 CCGGCAGGAGAGAGCCATCAGAG 0: 1
1: 0
2: 0
3: 35
4: 240
Right 1130990903 15:88875103-88875125 GGGAGTTGGGTTCCCTCCAAGGG 0: 1
1: 0
2: 1
3: 9
4: 121
1130990891_1130990896 -5 Left 1130990891 15:88875065-88875087 CCGGCAGGAGAGAGCCATCAGAG 0: 1
1: 0
2: 0
3: 35
4: 240
Right 1130990896 15:88875083-88875105 CAGAGGGACCTCCGCTGCCTGGG 0: 1
1: 0
2: 0
3: 16
4: 269
1130990891_1130990898 2 Left 1130990891 15:88875065-88875087 CCGGCAGGAGAGAGCCATCAGAG 0: 1
1: 0
2: 0
3: 35
4: 240
Right 1130990898 15:88875090-88875112 ACCTCCGCTGCCTGGGAGTTGGG 0: 1
1: 0
2: 0
3: 10
4: 169
1130990891_1130990902 14 Left 1130990891 15:88875065-88875087 CCGGCAGGAGAGAGCCATCAGAG 0: 1
1: 0
2: 0
3: 35
4: 240
Right 1130990902 15:88875102-88875124 TGGGAGTTGGGTTCCCTCCAAGG 0: 1
1: 0
2: 1
3: 24
4: 148
1130990891_1130990897 1 Left 1130990891 15:88875065-88875087 CCGGCAGGAGAGAGCCATCAGAG 0: 1
1: 0
2: 0
3: 35
4: 240
Right 1130990897 15:88875089-88875111 GACCTCCGCTGCCTGGGAGTTGG 0: 1
1: 0
2: 0
3: 17
4: 172
1130990891_1130990895 -6 Left 1130990891 15:88875065-88875087 CCGGCAGGAGAGAGCCATCAGAG 0: 1
1: 0
2: 0
3: 35
4: 240
Right 1130990895 15:88875082-88875104 TCAGAGGGACCTCCGCTGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130990891 Original CRISPR CTCTGATGGCTCTCTCCTGC CGG (reversed) Exonic