ID: 1130990895

View in Genome Browser
Species Human (GRCh38)
Location 15:88875082-88875104
Sequence TCAGAGGGACCTCCGCTGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 316}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130990887_1130990895 12 Left 1130990887 15:88875047-88875069 CCTCCTGCCGAGGGTAAGCCGGC 0: 1
1: 0
2: 1
3: 4
4: 51
Right 1130990895 15:88875082-88875104 TCAGAGGGACCTCCGCTGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 316
1130990890_1130990895 5 Left 1130990890 15:88875054-88875076 CCGAGGGTAAGCCGGCAGGAGAG 0: 1
1: 0
2: 0
3: 9
4: 163
Right 1130990895 15:88875082-88875104 TCAGAGGGACCTCCGCTGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 316
1130990885_1130990895 16 Left 1130990885 15:88875043-88875065 CCTGCCTCCTGCCGAGGGTAAGC 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1130990895 15:88875082-88875104 TCAGAGGGACCTCCGCTGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 316
1130990891_1130990895 -6 Left 1130990891 15:88875065-88875087 CCGGCAGGAGAGAGCCATCAGAG 0: 1
1: 0
2: 0
3: 35
4: 240
Right 1130990895 15:88875082-88875104 TCAGAGGGACCTCCGCTGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 316
1130990888_1130990895 9 Left 1130990888 15:88875050-88875072 CCTGCCGAGGGTAAGCCGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1130990895 15:88875082-88875104 TCAGAGGGACCTCCGCTGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130990895 Original CRISPR TCAGAGGGACCTCCGCTGCC TGG Exonic