ID: 1130990903

View in Genome Browser
Species Human (GRCh38)
Location 15:88875103-88875125
Sequence GGGAGTTGGGTTCCCTCCAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130990890_1130990903 26 Left 1130990890 15:88875054-88875076 CCGAGGGTAAGCCGGCAGGAGAG 0: 1
1: 0
2: 0
3: 9
4: 163
Right 1130990903 15:88875103-88875125 GGGAGTTGGGTTCCCTCCAAGGG 0: 1
1: 0
2: 1
3: 9
4: 121
1130990888_1130990903 30 Left 1130990888 15:88875050-88875072 CCTGCCGAGGGTAAGCCGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1130990903 15:88875103-88875125 GGGAGTTGGGTTCCCTCCAAGGG 0: 1
1: 0
2: 1
3: 9
4: 121
1130990891_1130990903 15 Left 1130990891 15:88875065-88875087 CCGGCAGGAGAGAGCCATCAGAG 0: 1
1: 0
2: 0
3: 35
4: 240
Right 1130990903 15:88875103-88875125 GGGAGTTGGGTTCCCTCCAAGGG 0: 1
1: 0
2: 1
3: 9
4: 121
1130990894_1130990903 1 Left 1130990894 15:88875079-88875101 CCATCAGAGGGACCTCCGCTGCC 0: 1
1: 0
2: 0
3: 20
4: 143
Right 1130990903 15:88875103-88875125 GGGAGTTGGGTTCCCTCCAAGGG 0: 1
1: 0
2: 1
3: 9
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130990903 Original CRISPR GGGAGTTGGGTTCCCTCCAA GGG Exonic