ID: 1130991185

View in Genome Browser
Species Human (GRCh38)
Location 15:88877095-88877117
Sequence GGTCCTGGGTGCTGGCCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130991185_1130991193 1 Left 1130991185 15:88877095-88877117 CCACTAGGCCAGCACCCAGGACC 0: 1
1: 0
2: 4
3: 41
4: 231
Right 1130991193 15:88877119-88877141 GGTGAACCATTGAGCAGGCAAGG 0: 1
1: 0
2: 2
3: 26
4: 321
1130991185_1130991191 -4 Left 1130991185 15:88877095-88877117 CCACTAGGCCAGCACCCAGGACC 0: 1
1: 0
2: 4
3: 41
4: 231
Right 1130991191 15:88877114-88877136 GACCGGGTGAACCATTGAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130991185 Original CRISPR GGTCCTGGGTGCTGGCCTAG TGG (reversed) Intergenic